SHOX2 (NM_006884) Human Untagged Clone

SKU
SC303842
SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SHOX2
Synonyms OG12; OG12X; SHOT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC303842 representing NM_006884.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGAACTTACGGCGTTCGTCTCCAAGTCTTTTGACCAGAAAGTGAAGGAGAAGAAGGAGGCGATC
ACGTACCGGGAGGTGCTGGAGAGCGGGCCGCTGCGCGGGGCCAAGGAGCCGACCGGCTGCACCGAGGCG
GGCCGCGACGACCGCAGCAGCCCGGCAGTCCGGGCGGCCGGCGGAGGCGGCGGCGGAGGAGGCGGAGGC
GGCGGCGGAGGAGGCGGAGGAGGTGTAGGAGGAGGAGGAGCAGGCGGAGGAGCTGGAGGAGGGCGCTCT
CCCGTCCGGGAGCTGGACATGGGCGCCGCCGAGAGAAGCAGGGAGCCGGGCAGCCCGCGACTGACGGAG
GTGTCCCCGGAGCTGAAAGATCGCAAAGAGGATGCGAAAGGGATGGAGGACGAAGGCCAGACCAAAATC
AAGCAGAGGCGAAGTCGGACCAATTTCACCCTGGAACAACTCAATGAGCTGGAGAGGCTTTTTGACGAG
ACCCACTATCCCGACGCCTTCATGCGAGAGGAACTGAGCCAGCGACTGGGCCTGTCGGAGGCCCGAGTG
CAGGTTTGGTTTCAAAATCGAAGAGCTAAATGTAGAAAACAAGAAAATCAACTCCATAAAGGTGTTCTC
ATAGGGGCCGCCAGCCAGTTTGAAGCTTGTAGAGTCGCACCTTATGTCAACGTAGGTGCTTTAAGGATG
CCATTTCAGCAGGATAGTCATTGCAACGTGACGCCCTTGTCCTTTCAGGTTCAGGCGCAGCTGCAGCTG
GACAGCGCTGTGGCGCACGCGCACCACCACCTGCATCCGCACCTGGCCGCGCACGCGCCCTACATGATG
TTCCCAGCACCGCCCTTCGGACTGCCGCTCGCCACGCTGGCCGCGGATTCGGCTTCCGCCGCCTCGGTA
GTGGCGGCCGCAGCAGCCGCCAAGACCACCAGCAAGAACTCCAGCATCGCCGATCTCAGACTGAAAGCC
AAAAAGCACGCCGCAGCCCTGGGTCTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006884
Insert Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006884.3
RefSeq Size 3161 bp
RefSeq ORF 996 bp
Locus ID 6474
UniProt ID O60902
Cytogenetics 3q25.32
Protein Families Transcription Factors
MW 35 kDa
Summary This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1, resulting in an isoform (a, also known as SHOX2a) that is shorter than isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SHOX2 (NM_006884) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219520 SHOX2 (Myc-DDK-tagged)-Human short stature homeobox 2 (SHOX2), transcript variant 2 10 ug
$300.00
RC219520L1 Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC219520L2 Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 2, mGFP tagged 10 ug
$600.00
RC219520L3 Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC219520L4 Lenti ORF clone of Human short stature homeobox 2 (SHOX2), transcript variant 2, mGFP tagged 10 ug
$600.00
RG219520 SHOX2 (tGFP-tagged) - Human short stature homeobox 2 (SHOX2), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.