FCN3 (NM_003665) Human Untagged Clone
SKU
SC303361
FCN3 (untagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | FCN3 |
Synonyms | FCNH; HAKA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC303361 representing NM_003665.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATCTACTGTGGATCCTGCCCTCCCTGTGGCTTCTCCTGCTTGGGGGGCCTGCCTGCCTGAAGACC CAGGAACACCCCAGCTGCCCAGGACCCAGGGAACTGGAAGCCAGCAAAGTTGTCCTCCTGCCCAGTTGT CCCGGAGCTCCAGGAAGTCCTGGGGAGAAGGGAGCCCCAGGTCCTCAAGGGCCACCTGGACCACCAGGC AAGATGGGCCCCAAGGGTGAGCCAGGAGATCCAGTGAACCTGCTCCGGTGCCAGGAAGGCCCCAGAAAC TGCCGGGAGCTGTTGAGCCAGGGCGCCACCTTGAGCGGCTGGTACCATCTGTGCCTACCTGAGGGCAGG GCCCTCCCAGTCTTTTGTGACATGGACACCGAGGGGGGCGGCTGGCTGGTGTTTCAGAGGCGCCAGGAT GGTTCTGTGGATTTCTTCCGCTCTTGGTCCTCCTACAGAGCAGGTTTTGGGAACCAAGAGTCTGAATTC TGGCTGGGAAATGAGAATTTGCACCAGCTTACTCTCCAGGGTAACTGGGAGCTGCGGGTAGAGCTGGAA GACTTTAATGGTAACCGTACTTTCGCCCACTATGCGACCTTCCGCCTCCTCGGTGAGGTAGACCACTAC CAGCTGGCACTGGGCAAGTTCTCAGAGGGCACTGCAGGGGATTCCCTGAGCCTCCACAGTGGGAGGCCC TTTACCACCTATGACGCTGACCACGATTCAAGCAACAGCAACTGTGCAGTGATTGTCCACGGTGCCTGG TGGTATGCATCCTGTTACCGATCAAATCTCAATGGTCGCTATGCAGTGTCTGAGGCTGCCGCCCACAAA TATGGCATTGACTGGGCCTCAGGCCGTGGTGTGGGCCACCCCTACCGCAGGGTTCGGATGATGCTTCGA TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_003665 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_003665.3 |
RefSeq Size | 1079 bp |
RefSeq ORF | 900 bp |
Locus ID | 8547 |
UniProt ID | O75636 |
Cytogenetics | 1p36.11 |
Protein Families | Druggable Genome, Secreted Protein |
MW | 32.9 kDa |
Summary | Ficolins are a group of proteins which consist of a collagen-like domain and a fibrinogen-like domain. In human serum, there are two types of ficolins, both of which have lectin activity. The protein encoded by this gene is a thermolabile beta-2-macroglycoprotein found in all human serum and is a member of the ficolin/opsonin p35 lectin family. The protein, which was initially identified based on its reactivity with sera from patients with systemic lupus erythematosus, has been shown to have a calcium-independent lectin activity. The protein can activate the complement pathway in association with MASPs and sMAP, thereby aiding in host defense through the activation of the lectin pathway. Alternative splicing occurs at this locus and two variants, each encoding a distinct isoform, have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC220435 | FCN3 (Myc-DDK-tagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1 | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
RC220435L1 | Lenti-ORF clone of FCN3 (Myc-DDK-tagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1 | 10 ug |
$600.00
|
|
RC220435L2 | Lenti-ORF clone of FCN3 (mGFP-tagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1 | 10 ug |
$600.00
|
|
RC220435L3 | Lenti-ORF clone of FCN3 (Myc-DDK-tagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1 | 10 ug |
$600.00
|
|
RC220435L4 | Lenti-ORF clone of FCN3 (mGFP-tagged)-Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1 | 10 ug |
$600.00
|
|
RG220435 | FCN3 (tGFP-tagged) - Human ficolin (collagen/fibrinogen domain containing) 3 (Hakata antigen) (FCN3), transcript variant 1 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.