Macrophage Inflammatory Protein 4 (CCL18) (NM_002988) Human Untagged Clone

SKU SC303259

CCL18 (untagged)-Human chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) (CCL18)

Product Data

• Type: Human Untagged Clone
• Target Symbol: Macrophage Inflammatory Protein 4
• Synonyms: AMAC-1; AMAC1; CKb7; DC-CK1; DCCK1; MIP-4; PARC; SCYA18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC303259 representing NM_002988.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGAAGGGCCTTGCAGCTGCCCTCCTTGTCCTCGTCTGCACCATGGCCCTCTGCTCCTGTGCACAAGTT; GGTACCAACAAAGAGCTCTGCTGCCTCGTCTATACCTCCTGGCAGATTCCACAAAAGTTCATAGTTGAC; TATTCTGAAACCAGCCCCCAGTGCCCCAAGCCAGGTGTCATCCTCCTAACCAAGAGAGGCCGGCAGATC; TGTGCTGACCCCAATAAGAAGTGGGTCCAGAAATACATCAGCGACCTGAAGCTGAATGCCTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_002988
• Insert Size: 270 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002988.3
• RefSeq Size: 798 bp
• RefSeq ORF: 270 bp
• Locus ID: 6362
• UniProt ID: P55774
• Cytogenetics: 17q12
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Chemokine signaling pathway, Cytokine-cytokine receptor interaction
• MW: 9.8 kDa
• Summary: This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for naive T cells, CD4+ and CD8+ T cells and nonactivated lymphocytes, but not for monocytes or granulocytes. This chemokine attracts naive T lymphocytes toward dendritic cells and activated macrophages in lymph nodes. It may play a role in both humoral and cell-mediated immunity responses. [provided by RefSeq, Sep 2014]