CCDC46 (CEP112) (NM_001037325) Human Untagged Clone

SKU SC302884

CEP112 (untagged)-Human centrosomal protein 112kDa (CEP112), transcript variant 2

Product Data

• Type: Human Untagged Clone
• Target Symbol: CCDC46
• Synonyms: CCDC46; MACOCO; SPGF44
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC302884 representing NM_001037325.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGTGGGCTTCTCTGAGTTTAGACCATCCATCTGCCAAGGAAAACCAAGCCCTGAGACTGATAGAGATG; AGAGAAGAGAATGGTAATGTCCCCAAGACAGAGCAGGCAGGAAGTTTGAAGCCTCTGAGGGATACAGGA; AAATCTAACCTCAAAGAGAAGAAGGCCAACAGCAAGCTGAAGCAGATTGAGAAGGAATACACTCAGAAG; CTTGCCAAATCTTCACAGATCATAGCAGAACTTCAGACAACCATTTCCTCTCTGAAAGAAGAGAACAGC; CAGCAGCAGCTTGCTGCAGAAAGGCGGCTCCAGGATGTTAGACAAAAGTTTGAAGATGAGAAGAAGCAG; CTGATTAGAGATAATGACCAAGCAATCAAGGTTTTACAAGATGAATTAGAAAACCGTTCTAATCAGGTG; CGATGTGCAGAGAAAAAATTACAACACAAAGAATTGGAGTCACAGGAACAGATAACTTACATACGACAA; GAATATGAAACAAAATTGAAAGGATTGATGCCAGCATCCCTAAGACAAGAACTTGAAGACACCATTTCC; TCCCTAAAATCACAGGTTAATTTTCTGCAAAAGAGAGCTTCCATCCTTCAGGAAGAACTGACTACATAT; CAAGGCAGAAGGTAA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037325
• Insert Size: 636 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001037325.2
• RefSeq Size: 1318 bp
• RefSeq ORF: 636 bp
• Locus ID: 201134
• UniProt ID: Q8N8E3
• Cytogenetics: 17q24.1
• MW: 24.5 kDa
• Summary: This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]; Transcript Variant: This variant (2) contains a distinct 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 3. The encoded isoform (b) has a distinct N-terminus and is shorter than isoform a.