C11orf85 (MAJIN) (NM_001037225) Human Untagged Clone

SKU SC302866

C11orf85 (untagged)-Human chromosome 11 open reading frame 85 (C11orf85)

Product Data

• Type: Human Untagged Clone
• Target Symbol: C11orf85
• Synonyms: C11orf85
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC302866 representing NM_001037225.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGAGTTTAAAACCCTTTACCTACCCGTTTCCAGAGACGAGGTTTCTTCATGCAGGACCCAATGTGTAT; AAATTCAAAATCAGATATGGGAAGAGTATCAGAGGAGAAGAGATAGAAAATAAGGAAGTCATCACCCAG; GAGCTGGAGGATTCTGTCCGCGTGGTCTTGGGAAACTTGGACAATCTTCAGCCCTTTGCTACAGAACAC; TTCATTGTATTTCCCTATAAAAGCAAATGGGAGAGAGTTTCCCACCTGAAATTCAAACATGGGGAAATT; ATCTTGATCCCCTACCCATTTGTTTTTACTCTATATGTGGAGATGAAATGGTTCCATGAAAACCTGTCA; CCTGGGAAACCAATAAGTGACAGTCCTCTTGGGTTGGTCCCAGTTGAGAAGAAAGCAGTAGGAGCTGTG; ATGAGGAAACGAAAACACATGGACGAGCCCAGCTCCCCCAGCAGGCCAGGGCTGGACAGAATAGGGAAA; GAAAAACCCAACAAGGATTGCAGGAGACTCTGGCCTCTGATATCACTGATGTCCAGAAACAAGATTCTG; AGTGGGGACACAGCCTGCCAGGGCGAATTGTCCCACCCCTGCAGCACAACTCACCTCCACCTAAGGAGC; GAGCAGCCACCGGCTTCTTTGGGTTTCTAA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001037225
• Insert Size: 651 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001037225.2
• RefSeq Size: 1291 bp
• RefSeq ORF: 651 bp
• Locus ID: 283129
• UniProt ID: Q3KP22
• Cytogenetics: 11q13.1
• MW: 24.8 kDa
• Summary: Meiosis-specific telomere-associated protein involved in meiotic telomere attachment to the nucleus inner membrane, a crucial step for homologous pairing and synapsis. Component of the MAJIN-TERB1-TERB2 complex, which promotes telomere cap exchange by mediating attachment of telomeric DNA to the inner nuclear membrane and replacement of the protective cap of telomeric chromosomes: in early meiosis, the MAJIN-TERB1-TERB2 complex associates with telomeric DNA and the shelterin/telosome complex. During prophase, the complex matures and promotes release of the shelterin/telosome complex from telomeric DNA. In the complex, MAJIN acts as the anchoring subunit to the nucleus inner membrane. MAJIN shows DNA-binding activity, possibly for the stabilization of telomere attachment on the nucleus inner membrane.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).