TAF5L (NM_001025247) Human Untagged Clone

SKU
SC302381
TAF5L (untagged)-Human TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TAF5L
Synonyms PAF65B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC302381 representing NM_001025247.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAACGAGTGCGTACCGAGCAGATTCAGATGGCAGTGTCCTGCTACCTCAAACGCCGGCAGTACGTG
GACTCAGATGGTCCCCTGAAGCAAGGACTGCGGCTGTCACAGACTGCTGAAGAGATGGCGGCCAATCTA
ACAGTGCAATCAGAATCTGGTTGTGCCAACATAGTGTCTGCAGCCCCTTGCCAGGCAGAACCCCAGCAA
TATGAAGTACAGTTTGGACGACTGCGGAATTTTCTCACTGATTCTGATTCCCAGCATAGCCACGAAGTG
ATGCCTCTCCTCTATCCTCTCTTTGTCTACCTCCATCTCAACCTGGTCCAAAACAGTCCGAAGAGCACA
GTGGAAAGTTTTTACAGCCGCTTCCATGGAATGTTTCTGCAGAATGCTAGCCAGAAGGATGTCATTGAG
CAGCTACAGACCACTCAAACCATCCAGGACATCCTATCTAACTTCAAGCTTCGAGCATTCCTAGATAAC
AAGTACGTGGTCCGTCTCCAAGAAGACAGCTACAACTACCTTATCCGCTACCTCCAAAGTGACAACAAT
ACTGCCCTGTGCAAAGTCCTCACCTTACATATTCATCTTGACGTGCAGCCTGCCAAGAGAACAGACTAT
CAGCTGTATGCCAGTGGCAGCTCCTCCCGCAGTGAGAACAACGGTTTGGAGCCCCCCGACATGCCCAGC
CCTATTCTGCAGAACGAGGCTGCCCTAGAGGTCTTACAGGAGAGCATTAAGCGAGTCAAGGATGGGCCT
CCCTCCCTCACTACCATCTGCTTCTATGCCTTCTATAACACAGAGCAGCTGTTGAACACTGCAGAAATC
TCCCCCGATAGCAAGCTGCTTGCTGCTGGGTTTGACAACTCCTGTATAAAACTTTGGAGTTTACGATCC
AAGAAGTTAAAATCAGAGCCCCACCAAGTAGACGTGTCCCGCATCCATTTGGCTTGTGATATTCTGGAG
GAGGAGGTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001025247
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025247.1
RefSeq Size 4139 bp
RefSeq ORF 978 bp
Locus ID 27097
UniProt ID O75529
Cytogenetics 1q42.13
Protein Families Transcription Factors
Protein Pathways Basal transcription factors
MW 37 kDa
Summary The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (b) contains a distinct N-terminus, compared to isoform a.
Write Your Own Review
You're reviewing:TAF5L (NM_001025247) Human Untagged Clone
Your Rating
SKU Description Size Price
RC207751 TAF5L (Myc-DDK-tagged)-Human TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 2 10 ug
$300.00
RC207751L3 Lenti ORF clone of Human TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC207751L4 Lenti ORF clone of Human TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 2, mGFP tagged 10 ug
$600.00
RG207751 TAF5L (tGFP-tagged) - Human TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa (TAF5L), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.