TRAPPC2 (NM_001011658) Human Untagged Clone

SKU
SC301588
TRAPPC2 (untagged)-Human trafficking protein particle complex 2 (TRAPPC2), transcript variant 1
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TRAPPC2
Synonyms hYP38334; MIP2A; SEDL; SEDT; TRAPPC2P1; TRS20; ZNF547L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301588 representing NM_001011658.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTGGGAGCTTCTACTTTGTAATTGTTGGCCACCATGATAATCCAGTTTTTGAAATGGAGTTTTTG
CCAGCTGGGAAGGCAGAATCCAAAGACGACCATCGTCATCTGAACCAGTTCATAGCTCATGCTGCTCTC
GACCTCGTAGATGAGAACATGTGGCTATCGAACAACATGTACTTGAAAACTGTGGACAAGTTCAACGAG
TGGTTTGTGTCGGCATTTGTCACTGCGGGGCATATGAGGTTTATTATGCTTCATGACATAAGACAAGAA
GATGGAATAAAGAACTTCTTTACTGATGTTTATGATTTATATATAAAGTTTTCAATGAATCCATTTTAT
GAACCCAATTCTCCTATTCGATCAAGTGCATTTGACAGAAAAGTTCAGTTTCTTGGGAAGAAACACCTT
TTAAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001011658
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001011658.3
RefSeq Size 2869 bp
RefSeq ORF 423 bp
Locus ID 6399
UniProt ID P0DI81
Cytogenetics Xp22.2
Protein Families Druggable Genome, Transcription Factors
MW 16.4 kDa
Summary The protein encoded by this gene is thought to be part of a large multi-subunit complex involved in the targeting and fusion of endoplasmic reticulum-to-Golgi transport vesicles with their acceptor compartment. In addition, the encoded protein can bind c-myc promoter-binding protein 1 and block its transcriptional repression capability. Mutations in this gene are a cause of spondyloepiphyseal dysplasia tarda (SEDT). A processed pseudogene of this gene is located on chromosome 19, and other pseudogenes are found on chromosomes 8 and Y. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (1) encodes the shorter isoform (1). Variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:TRAPPC2 (NM_001011658) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208617 TRAPPC2 (Myc-DDK-tagged)-Human trafficking protein particle complex 2 (TRAPPC2), transcript variant 1 10 ug
$150.00
RC208617L3 Lenti ORF clone of Human trafficking protein particle complex 2 (TRAPPC2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC208617L4 Lenti ORF clone of Human trafficking protein particle complex 2 (TRAPPC2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG208617 TRAPPC2 (tGFP-tagged) - Human trafficking protein particle complex 2 (TRAPPC2), transcript variant 1 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.