RHEX (NM_001007544) Human Untagged Clone

SKU
SC301238
C1orf186 (untagged)-Human chromosome 1 open reading frame 186 (C1orf186)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RHEX
Synonyms C1orf186
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC301238 representing NM_001007544.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGACAGAAGTCATGGAGGTCTGGCATGGCTTAGTGATCGCGGTGGTGTCCCTCTTCCTGCAGGCC
TGCTTCCTCACCGCCATCAACTACCTGCTCAGCAGGCACATGGCCCACAAGAGTGAACAGATACTGAAA
GCGGCCAGTCTCCAGGTTCCCAGGCCCAGCCCTGGCCACCATCATCCACCTGCTGTCAAAGAGATGAAG
GAGACTCAGACAGAGAGAGACATCCCAATGTCTGATTCCCTTTACAGGCATGACAGCGACACACCCTCA
GATAGCTTGGATAGCTCCTGCAGTTCGCCTCCTGCCTGCCAGGCCACAGAGGATGTGGATTACACACAA
GTCGTCTTTTCTGACCCTGGAGAACTAAAAAATGACTCCCCGCTGGACTATGAGAACATAAAGGAAATC
ACAGATTATGTCAATGTCAATCCAGAAAGACACAAGCCCAGTTTCTGGTATTTTGTCAACCCTGCTCTG
TCTGAGCCAGCGGAATATGATCAAGTGGCCATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001007544
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007544.3
RefSeq Size 1684 bp
RefSeq ORF 519 bp
Locus ID 440712
UniProt ID Q6ZWK4
Cytogenetics 1q32.1
Protein Families Transmembrane
MW 19.4 kDa
Summary Acts as a signaling transduction factor of the EPO-EPOR signaling pathway promoting erythroid cell differentiation (PubMed:25092874).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:RHEX (NM_001007544) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210024 C1orf186 (Myc-DDK-tagged)-Human chromosome 1 open reading frame 186 (C1orf186) 10 ug
$300.00
RC210024L1 Lenti ORF clone of Human chromosome 1 open reading frame 186 (C1orf186), Myc-DDK-tagged 10 ug
$600.00
RC210024L2 Lenti ORF clone of Human chromosome 1 open reading frame 186 (C1orf186), mGFP tagged 10 ug
$600.00
RC210024L3 Lenti ORF clone of Human chromosome 1 open reading frame 186 (C1orf186), Myc-DDK-tagged 10 ug
$600.00
RC210024L4 Lenti ORF clone of Human chromosome 1 open reading frame 186 (C1orf186), mGFP tagged 10 ug
$600.00
RG210024 C1orf186 (tGFP-tagged) - Human chromosome 1 open reading frame 186 (C1orf186) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.