MTP18 (MTFP1) (NM_001003704) Human Untagged Clone

SKU
SC300528
MTFP1 (untagged)-Human mitochondrial fission process 1 (MTFP1), nuclear gene encoding mitochondrial protein, transcript variant 2
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MTP18
Synonyms HSPC242; MTP18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300528 representing NM_001003704.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCAGAGCCGCAGCCGCGGGGCGCAGAGCGCGATCTCTACCGGGACACGTGGGTGCGATACCTGGGC
TATGCCAATGAGGTGGGCGAGGCTTTCCGCTCTCTTGTGCCAGCGGCGGTGGTGTGGCTGAGCTATGGC
GTGGCCAGCTCCTACGTGCTGGCGGATGCCATTGACAAAGGCAAGAAGGCTGGAGAGGTCGGTGGATTT
CCTCCTGGACTCCAGCCTGCGCAAGCTCTACCCAACAGTGGGGAAGCCCAGCTCCTCCTGATCATACTC
TGGTACCTGGCCTGTGCATCGGCCTCCTGCTTCATGTCAACCTCCTACTCCTGCCAGGGAATGTGGACA
CCTGGCTCCCTGGTGTCCAAAGACCCTGGCACCTGGGTGGGTTTGAGCTGGACAGAAGCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001003704
Insert Size 408 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001003704.2
RefSeq Size 1065 bp
RefSeq ORF 408 bp
Locus ID 51537
UniProt ID Q9UDX5
Cytogenetics 22q12.2
MW 14.5 kDa
Summary MTP18 is a mitochondrial protein and downstream target of the phosphatidylinositol 3-kinase (see PIK3CA, MIM 171834) signaling pathway that plays a role in cell viability and mitochondrial dynamics (Tondera et al., 2004 [PubMed 15155745]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a.
Write Your Own Review
You're reviewing:MTP18 (MTFP1) (NM_001003704) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211840 MTFP1 (Myc-DDK-tagged)-Human mitochondrial fission process 1 (MTFP1), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$150.00
RC211840L3 Lenti ORF clone of Human mitochondrial fission process 1 (MTFP1), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC211840L4 Lenti ORF clone of Human mitochondrial fission process 1 (MTFP1), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged 10 ug
$450.00
RG211840 MTFP1 (tGFP-tagged) - Human mitochondrial fission process 1 (MTFP1), nuclear gene encoding mitochondrial protein, transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.