SLC10A2 (NM_000452) Human Untagged Clone

SKU
SC300073
SLC10A2 (untagged)-Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLC10A2
Synonyms ASBT; IBAT; ISBT; NTCP2; PBAM
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC300073 representing NM_000452.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAATGATCCGAACAGCTGTGTGGACAATGCAACAGTTTGCTCTGGTGCATCCTGTGTGGTACCTGAG
AGCAATTTCAATAACATCCTAAGTGTGGTCCTAAGTACGGTGCTGACCATCCTGTTGGCCTTGGTGATG
TTCTCCATGGGATGCAACGTGGAAATCAAGAAATTTCTAGGGCACATAAAGCGGCCGTGGGGCATTTGT
GTTGGCTTCCTCTGTCAGTTTGGAATCATGCCCCTCACAGGATTCATCCTGTCGGTGGCCTTTGACATC
CTCCCGCTCCAGGCCGTAGTGGTGCTCATTATAGGATGCTGCCCTGGAGGAACTGCCTCCAATATCTTG
GCCTATTGGGTCGATGGCGACATGGACCTGAGCGTCAGCATGACCACATGCTCCACACTGCTTGCCCTC
GGAATGATGCCGCTGTGCCTCCTTATCTATACCAAAATGTGGGTCGACTCTGGGAGCATCGTAATTCCC
TATGATAACATAGGTACATCTCTGGTTGCTCTCGTTGTTCCTGTTTCCATTGGAATGTTTGTTAATCAC
AAATGGCCCCAAAAAGCAAAGATCATACTTAAAATTGGGTCCATCGCGGGCGCCATCCTCATTGTGCTC
ATAGCTGTGGTTGGAGGAATATTGTACCAAAGCGCCTGGATCATTGCTCCCAAACTGTGGATTATAGGA
ACAATATTTCCTGTGGCGGGTTACTCCCTGGGGTTTCTTCTGGCTAGAATTGCTGGTCTACCCTGGTAC
AGGTGCCGAACGGTTGCTTTTGAAACGGGGATGCAGAACACGCAGCTATGTTCCACCATCGTTCAGCTC
TCCTTCACTCCTGAGGAGCTCAATGTCGTATTCACCTTCCCGCTCATCTACAGCATTTTCCAGCTCGCC
TTTGCCGCAATATTCTTAGGATTTTATGTGGCATACAAGAAATGTCATGGAAAAAACAAGGCAGAAATT
CCAGAGAGCAAAGAAAATGGAACGGAGCCAGAGTCATCGTTTTATAAGGCAAATGGAGGATTTCAACCT
GACGAAAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_000452
Insert Size 1047 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000452.2
RefSeq Size 3779 bp
RefSeq ORF 1047 bp
Locus ID 6555
UniProt ID Q12908
Cytogenetics 13q33.1
Protein Families Druggable Genome, Transmembrane
MW 37.7 kDa
Summary This gene encodes a sodium/bile acid cotransporter. This transporter is the primary mechanism for uptake of intestinal bile acids by apical cells in the distal ileum. Bile acids are the catabolic product of cholesterol metabolism, so this protein is also critical for cholesterol homeostasis. Mutations in this gene cause primary bile acid malabsorption (PBAM); muatations in this gene may also be associated with other diseases of the liver and intestines, such as familial hypertriglyceridemia (FHTG). [provided by RefSeq, Mar 2010]
Write Your Own Review
You're reviewing:SLC10A2 (NM_000452) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221202 SLC10A2 (Myc-DDK-tagged)-Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2) 10 ug
$686.00
RC221202L1 Lenti ORF clone of Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2), Myc-DDK-tagged 10 ug
$986.00
RC221202L2 Lenti ORF clone of Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2), mGFP tagged 10 ug
$986.00
RC221202L3 Lenti ORF clone of Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2), Myc-DDK-tagged 10 ug
$986.00
RC221202L4 Lenti ORF clone of Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2), mGFP tagged 10 ug
$986.00
RG221202 SLC10A2 (tGFP-tagged) - Human solute carrier family 10 (sodium/bile acid cotransporter family), member 2 (SLC10A2) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.