PPAR gamma (PPARG) (NM_138712) Human Untagged Clone

CAT#: SC124177

PPARG (untagged)-Human peroxisome proliferator-activated receptor gamma (PPARG), transcript variant 1

USD 505


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PPAR gamma (PPARG) (NM_138712) Human Untagged Clone
Symbol PPARG
Synonyms CIMT1; GLM1; NR1C3; PPARG1; PPARG2; PPARgamma
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_138712 edited
GGCGCCCGCGCCCGCCCCCGCGCCGGGCCCGGCTCGGCCCGACCCGGCTCCGCCGCGGGC
AGGCGGGGCCCAGCGCACTCGGAGCCCGAGCCCGAGCCGCAGCTGCCGCCTGGGGCGCTT
GGGTCGGCCTCGAGGACACCGGAGAGGGGCGCCACGCCGCCGTGGCCGCAGATTTGAAAG
AAGCCAACACTAAACCACAAATATACAACAAGGCCATTTTCTCAAACGAGAGTCAGCCTT
TAACGAAATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAG
CTCCGTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCAC
TACTGTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATTCACAAGAAC
AGATCCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAAT
CAAAGTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCC
TCATGAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGC
TTCTGGATTTCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTCTTCCGGAGAAC
AATCAGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAG
TAGAAATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAA
TGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGGAGAAGCTGTTGGCGGAGATCTC
CAGTGATATCGACCAGCTGAATCCAGAGTCCGCTGACCTCCGGGCCCTGGCAAAACATTT
GTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCAAAGGCGAGGGCGATCTTGAC
AGGAAAGACAACAGACAAATCACCATTCGTTATCTATGACATGAATTCCTTAATGATGGG
AGAAGATAAAATCAAGTTCAAACACATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGC
CATCCGCATCTTTCAGGGCTGCCAGTTTCGCTCCGTGGAGGCTGTGCAGGAGATCACAGA
GTATGCCAAAAGCATTCCTGGTTTTGTAAATCTTGACTTGAACGACCAAGTAACTCTCCT
CAAATATGGAGTCCACGAGATCATTTACACAATGCTGGCCTCCTTGATGAATAAAGATGG
GGTTCTCATATCCGAGGGCCAAGGCTTCATGACAAGGGAGTTTCTAAAGAGCCTGCGAAA
GCCTTTTGGTGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGA
ATTAGATGACAGCGACTTGGCAATATTTATTGCTGTCATTATTCTCAGTGGAGACCGCCC
AGGTTTGCTGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGA
GCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAA
AATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAA
GACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTA
GCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCAGTTGCACTATTCTGAGGGA
AAATCTGACACCTAAGAAATTTACTGTGAAAAAGCATTTTAAAAAGAAAAGGTTTTAGAA
TATGATCTATTTTATGCATATTGTTTATAAAGACACATTTACAATTTACTTTTAATAT
TAAAAATTACCATATTATGAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_138712 unedited
CCAGCATTTTGTAATACGACTTCACTATAGGGCGGCCGCGATTCGGCACCANAGCCGGCG
CCCGCGCCCGCCCCCGCGCCGGGCCCGGCTCGGCCCGACCCGGCTCCGCCGCGGGCAGGC
GGGGCCCAGCGCACTCGGAGCCCGAGCCCGAGCCGCAGCTGCCGCCTGGGGCGCTTGGGT
CGGCCTCGAGGACACCGGAGAGGGGCGCCACGCCGCCGTGGCCGCAGATTTGAAAGAAGC
CAACACTAAACCACAAATATACAACAAGGCCATTTTCTCAAACGAGAGTCAGCCTTTAAC
GAAATGACCATGGTTGACACAGAGATGCCATTCTGGCCCACCAACTTTGGGATCAGCTCC
GTGGATCTCTCCGTAATGGAAGACCACTCCCACTCCTTTGATATCAAGCCCTTCACTACT
GTTGACTTCTCCAGCATTTCTACTCCACATTACGAAGACATTCCATTCACAAGAACAGAT
CCAGTGGTTGCAGATTACAAGTATGACCTGAAACTTCAAGAGTACCAAAGTGCAATCAAA
GTGGAGCCTGCATCTCCACCTTATTATTCTGAGAAGACTCAGCTCTACAATAAGCCTCAT
GAAGAGCCTTCCAACTCCCTCATGGCAATTGAATGTCGTGTCTGTGGAGATAAAGCTTCT
GGATTTCACTATGGAGTTCATGCTTGTGAAGGGATGCAGGGTTTCTTCCGGAGAAACATC
AGATTGAAGCTTATCTATGACAGATGTGATCTTAACTGTCGGATCCACAAAAAAAGTAGA
AATAAATGTCAGTACTGTCGGTTTCAGAAATGCCTTGCAGTGGGGATGTCTCATAATGCC
ATCAGGTTTGGGGCGGATGCCACAGGCCGAGNAAGAGAAAGCTGTGGCCGGAAATCTCCA
GTGATATCGACCAGCTGAATCCAGAGTCGCTGACCTCCGGCCCTGGCAAACTTTGTATGA
CTCATCATAAAGTCTTCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_138712 unedited
GCCGCGCCATTTGGGTGATGGCAACTTCCCAGTTTCGGNAAAGCACTGGGGCAGGGTCAC
AGGGATGCCACCCGGGTTCTGTTCAGGAAAACAGCTATGACCGCGGCCGCAATCTAGAGT
CGAGTTTTTTTTTTTTTTTTTTTTCATAATATGGTAATTTTTAATATTAAAAGTAAATTG
TAAATGTGTCTTTATAAACAATATGCATAAAATAGATCATATTCTAAAACCTTTTCTTTT
TAAAATGCTTTTTCACAGTAAATTTCTTAGGTGTCAGATTTTCCCTCAGAATAGTGCAAC
TGGAAAAAGGGAAATGTTGGCAGTGGCTCAGGACTCTCTGCTAGTACAAGTCCTTGTAGA
TCTCCTGCAGGAGCGGGTGAAGACTCATGTCTGTCTCCGTTTTCTTGATCACCTGCAGTA
GCTGCACGTGTTCCGTGACAATCTGTCTGAGGTCTGTCATTTTCTGGAGCAGCTTGGCAA
ACAGCTGTGAGGACTCAGGGTGGTTCAGCTTCAGCTGGAGCTCCAGGGCTTGTAGCAGGT
TGTCTTGAATGTCTTCAATGGGCTTCACATTCAGAAAACCTGGGCGGTCTCCACTGAGAA
TAATGACAGCAATAAATATTGCCAAGTCGCTGTCATCTAATTCCAGTGCATTGAACTTCA
CAGCAAACTCAAACTTGGGCTCAATAAAGTGACCAAAAGGCTTTCGCAGGCTCTTTAGAA
ACTCCCTTGTCATGAAGTCTTGGCCCTCCGAATATGAAACCCTATCTTTTTTCTTAAGGA
GGCCCGCTTGGGGTAATGAATCTCGGGACTCCATATTTTAAGAGAATACCTCGTCCGTTA
AGTCAATATTACAAACCAGGAATGCTTTTGGCATCTGTGGTGGACCCCAGCAAAACCTCG
CAGAAAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_138712
ORF Size 1428 bp
Insert Size 2000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_138712.2, NP_619726
RefSeq Size 1883
RefSeq ORF 1428
Locus ID 5468
Cytogenetics 3p25.2
Domains HOLI, zf-C4
Protein Families Nuclear Hormone Receptor, Transcription Factors, Druggable Genome
Protein Pathways PPAR signaling pathway, Huntington's disease, Pathways in cancer, Thyroid cancer
Gene Summary This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region compared to variant 2. Variants 1, 3, and 4 encode the same isoform (1), which has a shorter, distinct N-terminus compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.