DUOXA1 (NM_144565) Human Untagged Clone

SKU
SC123168
DUOXA1 (untagged)-Human dual oxidase maturation factor 1 (DUOXA1)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DUOXA1
Synonyms mol; NIP; NUMBIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_144565 edited
CTTCCAGCGGACGGCAGCGCGCGAGACCAGGCCAGGCGTCAAAGCAAGTCACCCATCCGA
CCTAAACCCCTCTAAGACCCTGGAGTCACGTCTCCCTCCGGGGATCCTCGTGAGGTCTTG
GGGGTCCCACCGCCCTGCGAGCCGCGCCCGCGCCCCGCCAGACCCGGAACTGCGTCGCTA
GAACGTCGGGACCTGGTTCCCTCTTTAATCACACCCCCGGGGGCGCTTCGTGTGAGGTTC
CACGGGGGAAGGCGAGAGGCGCAGGCTGCCACACACGCACTGTTTGGAAGAGGGGAAGGG
CTGCACTTCCTGCTTTCATCCAGACCAAGTTCGGATCAAGTGGGAGTTCTTCAAAGAGAG
AGTTTGCATTGCCCCCCCTGCACCACCTCACCAAGATGGCTACTTTGGGACACACATTCC
CCTTCTATGCTGGCCCCAAGCCAACCTTCCCGATGGACACCACTTTGGCCAGCATCATCA
TGATCTTTCTGACTGCACTGGCCACGTTCATCGTCATCCTGCCTGGCATTCGGGGAAAGA
CGAGGCTGTTCTGGCTGCTTCGGGTGGTGACCAGCTTATTCATCGGGGCTGCAATCCTGG
GGACCCCCGTGCAGCAGCTGAATGAGACCATCAATTACAACGAGGAGTTCACCTGGCGCC
TGGGTGAGAACTATGCTGAGGAGTATGCAAAGGCTCTGGAGAAGGGGCTGCCAGACCCTG
TGTTGTACCTAGCTGAGAAGTTCACTCCAAGAAGCCCATGTGGCCTATACCGCCAGTACC
GCCTGGCGGGACACTACACCTCAGCCATGCTATGGGTGGCATTCCTCTGCTGGCTGCTGG
CCAATGTGATGCTCTCCATGCCTGTGCTGGTATATGGTGGCTACATGCTATTGGCCACGG
GCATCTTCCAGCTGTTGGCTCTGCTCTTCTTCTCCATGGCCACATCACTCACCTCACCCT
GTCCCCTGCACCTGGGCGCTTCTGTGCTGCATACTCACCATGGGCCTGCCTTCTGGATCA
CATTGACCACAGGACTGCTGTGTGTGCTGCTGGGCCTGGCTATGGCGGTGGCCCACAGGA
TGCAGCCTCACAGGCTGAAGGCTTTCTTCAACCAGAGTGTGGATGAAGACCCCATGCTGG
AGTGGAGTCCTGAGGAAGGTGGACTCCTGAGCCCCCGCTACCGGTCCATGGCTGACAGTC
CCAAGTCCCAGGACATTCCCCTGTCAGAGGCTTCCTCCACCAAGGCATACTGTAAGGAGG
CACACCCCAAAGATCCTGATTGTGCTTTATAACATTCCTCCCCGTGGAGGCCACCTGGAC
TTCCAGTCTGGCTCCAAACCTCATTGGCGCCCCATAAAACCAGCAGAACTGCCCTCAGGG
TGGCTGTTACCAGACACCCAGCACCAATCTACAGACGGAGTAGAAAAAGGAGGCTCTATA
TACTGATGTTAAAAAACAAAACAAAACAAAAAGCCCTAAGGGACTGAAGAGATGCTGGGC
CTGTCCATAAAGCCTGTTGCCATGATAAGGCCAAGCAGGGGCTAGCTTATCTGCACAGCA
ACCCAGCCTTTCCGTGCTGCCTTGCCTCTTCAAGATGCTATTCACTGAAACCTAACTTCA
CCCCCATAACACCAGCAGGGTGGGGGTTACATATGATTCTCCTATGGTTTCCTCGCAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites Please inquire
ACCN NM_144565
Insert Size 1706 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_144565.2, NP_653166.2
RefSeq Size 1923 bp
RefSeq ORF 1452 bp
Locus ID 90527
UniProt ID Q1HG43
Cytogenetics 15q21.1
Protein Families Transmembrane
Summary Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (1) encodes the longest isoform (1, also known as gamma). Variants 1 and 2 encode the same isoform 1.
Write Your Own Review
You're reviewing:DUOXA1 (NM_144565) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206754 DUOXA1 (Myc-DDK-tagged)-Human dual oxidase maturation factor 1 (DUOXA1) 10 ug
$686.00
RC206754L3 Lenti ORF clone of Human dual oxidase maturation factor 1 (DUOXA1), Myc-DDK-tagged 10 ug
$986.00
RC206754L4 Lenti ORF clone of Human dual oxidase maturation factor 1 (DUOXA1), mGFP tagged 10 ug
$986.00
RG206754 DUOXA1 (tGFP-tagged) - Human dual oxidase maturation factor 1 (DUOXA1) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.