P Glycoprotein(ABCB1) (NM_000927) Human Untagged Clone

CAT#: SC119584

ABCB1 (untagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1)

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name P Glycoprotein(ABCB1) (NM_000927) Human Untagged Clone
Symbol ABCB1
Synonyms ABC20; CD243; CLCS; GP170; MDR1; P-GP; PGY1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000927 edited
CAAGCTCAAAGAAGCAGAGGCCGCTGTTCGTTTCCTTTAGGTCTTTCCACTAAAGTCGGA
GTATCTTCTTCCAAAATTTCACGTCTTGGTGGCCGTTCCAAGGAGCGCGAGGTCGGGATG
GATCTTGAAGGGGACCGCAATGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGAACAAT
AAAAGTGAAAAAGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTCAATGTTTCGC
TATTCAAATTGGCTTGACAAGTTGTATATGGTGGTGGGAACTTTGGCTGCCATCATCCAT
GGGGCTGGACTTCCTCTCATGATGCTGGTGTTTGGAGAAATGACAGATATCTTTGCAAAT
GCAGGAAATTTAGAAGATCTGATGTCAAACATCACTAATAGAAGTGATATCAATGATACA
GGGTTCTTCATGAATCTGGAGGAAGACATGACCAGGTATGCCTATTATTACAGTGGAATT
GGTGCTGGGGTGCTGGTTGCTGCTTACATTCAGGTTTCATTTTGGTGCCTGGCAGCTGGA
AGACAAATACACAAAATTAGAAAACAGTTTTTTCATGCTATAATGCGACAGGAGATAGGC
TGGTTTGATGTGCACGATGTTGGGGAGCTTAACACCCGACTTACAGATGATGTCTCCAAG
ATTAATGAAGGAATTGGTGACAAAATTGGAATGTTCTTTCAGTCAATGGCAACATTTTTC
ACTGGGTTTATAGTAGGATTTACACGTGGTTGGAAGCTAACCCTTGTGATTTTGGCCATC
AGTCCTGTTCTTGGACTGTCAGCTGCTGTCTGGGCAAAGATACTATCTTCATTTACTGAT
AAAGAACTCTTAGCGTATGCAAAAGCTGGAGCAGTAGCTGAAGAGGTCTTGGCAGCAATT
AGAACTGTGATTGCATTTGGAGGACAAAAGAAAGAACTTGAAAGGTACAACAAAAATTTA
GAAGAAGCTAAAAGAATTGGGATAAAGAAAGCTATTACAGCCAATATTTCTATAGGTGCT
GCTTTCCTGCTGATCTATGCATCTTATGCTCTGGCCTTCTGGTATGGGACCACCTTGGTC
CTCTCAGGGGAATATTCTATTGGACAAGTACTCACTGTATTCTTTTCTGTATTAATTGGG
GCTTTTAGTGTTGGACAGGCATCTCCAAGCATTGAAGCATTTGCAAATGCAAGAGGAGCA
GCTTATGAAATCTTCAAGATAATTGATAATAAGCCAAGTATTGACAGCTATTCGAAGAGT
GGGCACAAACCAGATAATATTAAGGGAAATTTGGAATTCAGAAATGTTCACTTCAGTTAC
CCATCTCGAAAAGAAGTTAAGATCTTGAAGGGTCTGAACCTGAAGGTGCAGAGTGGGCAG
ACGGTGGCCCTGGTTGGAAACAGTGGCTGTGGGAAGAGCACAACAGTCCAGCTGATGCAG
AGGCTCTATGACCCCACAGAGGGGATGGTCAGTGTTGATGGACAGGATATTAGGACCATA
AATGTAAGGTTTCTACGGGAAATCATTGGTGTGGTGAGTCAGGAACCTGTATTGTTTGCC
ACCACGATAGCTGAAAACATTCGCTATGGCCGTGAAAATGTCACCATGGATGAGATTGAG
AAAGCTGTCAAGGAAGCCAATGCCTATGACTTTATCATGAAACTGCCTCATAAATTTGAC
ACCCTGGTTGGAGAGAGAGGGGCCCAGTTGAGTGGTGGGCAGAAGCAGAGGATCGCCATT
GCACGTGCCCTGGTTCGCAACCCCAAGATCCTCCTGCTGGATGAGGCCACGTCAGCCTTG
GACACAGAAAGCGAAGCAGTGGTTCAGGTGGCTCTGGATAAGGCCAGAAAAGGTCGGACC
ACCATTGTGATAGCTCATCGTTTGTCTACAGTTCGTAATGCTGACGTCATCGCTGGTTTC
GATGATGGAGTCATTGTGGAGAAAGGAAATCATGATGAACTCATGAAAGAGAAAGGCATT
TACTTCAAACTTGTCACAATGCAGACAGCAGGAAATGAAGTTGAATTAGAAAATGCAGCT
GATGAATCCAAAAGTGAAATTGATGCCTTGGAAATGTCTTCAAATGATTCAAGATCCAGT
CTAATAAGAAAAAGATCAACTCGTAGGAGTGTCCGTGGATCACAAGCCCAAGACAGAAAG
CTTAGTACCAAAGAGGCTCTGGATGAAAGTATACCTCCAGTTTCCTTTTGGAGGATTATG
AAGCTAAATTTAACTGAATGGCCTTATTTTGTTGTTGGTGTATTTTGTGCCATTATAAAT
GGAGGCCTGCAACCAGCATTTGCAATAATATTTTCAAAGATTATAGGGGTTTTTACAAGA
ATTGATGATCCTGAAACAAAACGACAGAATAGTAACTTGTTTTCACTATTGTTTCTAGCC
CTTGGAATTATTTCTTTTATTACATTTTTCCTTCAGGGTTTCACATTTGGCAAAGCTGGA
GAGATCCTCACCAAGCGGCTCCGATACATGGTTTTCCGATCCATGCTCAGACAGGATGTG
AGTTGGTTTGATGACCCTAAAAACACCACTGGAGCATTGACTACCAGGCTCGCCAATGAT
GCTGCTCAAGTTAAAGGGGCTATAGGTTCCAGGCTTGCTGTAATTACCCAGAATATAGCA
AATCTTGGGACAGGAATAATTATATCCTTCATCTATGGTTGGCAACTAACACTGTTACTC
TTAGCAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGA
CAAGCACTGAAAGATAAGAAAGAACTAGAAGGTTCTGGGAAGATCGCTACTGAAGCAATA
GAAAACTTCCGAACCGTTGTTTCTTTGACTCAGGAGCAGAAGTTTGAACATATGTATGCT
CAGAGTTTGCAGGTACCATACAGAAACTCTTTGAGGAAAGCACACATCTTTGGAATTACA
TTTTCCTTCACCCAGGCAATGATGTATTTTTCCTATGCTGGATGTTTCCGGTTTGGAGCC
TACTTGGTGGCACATAAACTCATGAGCTTTGAGGATGTTCTGTTAGTATTTTCAGCTGTT
GTCTTTGGTGCCATGGCCGTGGGGCAAGTCAGTTCATTTGCTCCTGACTATGCCAAAGCC
AAAATATCAGCAGCCCACATCATCATGATCATTGAAAAAACCCCTTTGATTGACAGCTAC
AGCACGGAAGGCCTAATGCCGAACACATTGGAAGGAAATGTCACATTTGGTGAAGTTGTA
TTCAACTATCCCACCCGACCGGACATCCCAGTGCTTCAGGGACTGAGCCTGGAGGTGAAG
AAGGGCCAGACGCTGGCTCTGGTGGGCAGCAGTGGCTGTGGGAAGAGCACAGTGGTCCAG
CTCCTGGAGCGGTTCTACGACCCCTTGGCAGGGAAAGTGCTGCTTGATGGCAAAGAAATA
AAGCGACTGAATGTTCAGTGGCTCCGAGCACACCTGGGCATCGTGTCCCAGGAGCCCATC
CTGTTTGACTGCAGCATTGCTGAGAACATTGCCTATGGAGACAACAGCCGGGTGGTGTCA
CAGGAAGAGATTGTGAGGGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACTG
CCTAATAAATATAGCACTAAAGTAGGAGACAAAGGAACTCAGCTCTCTGGTGGCCAGAAA
CAACGCATTGCCATAGCTCGTGCCCTTGTTAGACAGCCTCATATTTTGCTTTTGGATGAA
GCCACGTCAGCTCTGGATACAGAAAGTGAAAAGGTTGTCCAAGAAGCCCTGGACAAAGCC
AGAGAAGGCCGCACCTGCATTGTGATTGCTCACCGCCTGTCCACCATCCAGAATGCAGAC
TTAATAGTGGTGTTTCAGAATGGCAGAGTCAAGGAGCATGGCACGCATCAGCAGCTGCTG
GCACAGAAAGGCATCTATTTTTCAATGGTCAGTGTCCAGGCTGGAACAAAGCGCCAGTGA
ACTCTGACTGTATGAGATGTTAAATACTTTTTAATATTTGTTTAGATATGACATTTATTC
AAAGTTAAAAGCAAACACTTACAGAATTATGAAGAGGTATCTGTTTAACATTTCCTCAGT
CAAGTTCAGAGTCTTCAGAGACTTCGTAATTAAAGGAACAGAGTGAGAGACATCATCAAG
TGGAGAGAAATCATAGTTTAAACTGCATTATAAATTTTATAACAGAATTAAAGTAGATTT
TAAAAGATAAAATGTGTAATTTTGTTTATATTTTCCCATTTGGACTGTAACTGACTGCCT
TGCTAAAAGATTATAGAAGTAGCAAAAAGTATTGAAATGTTTGCATAAAGTGTCTATAAT
AAAACTAAACTTTCATGTGACTGGAGTCATCTTGTCCAAACTGCCTGTGAATATATCTTC
TCTCAATTGGAATATTGTAGATAACTTCTGCTTTAAAAAAGTTTTCTTTAAATATACCTA
CTCATTTTTGTGGGAATGGTTAAGCAGTTTAAATAATTCCTGTTGTATATGTCTATTCAC
ATTGGGTCTTACAGAACCATCTGGCTTCATTCTTCTTGGACTTGATCCTGCTGATTCTTG
CATTTCCACATTAAGGTGGCTCTCAAACCCAAAACACAGATCGATATAAGATTTTAGGAG
GTGGGGTGAGGCACAATTATGAAGTGCATATTATTCAGATGTATAGTAAATACTTTGCAT
TGCTTTTATAAAGGGTTCTTTAAGGATTTTTTAAGATTTTTACACTTCCAAAGTACATTT
ACTTTTTGTCTTGATAATGAATCACTTTTGCCAGTAATTGGCCTCTTCCAAAAGTGATCC
TTCTGACTTACAGATGTTTAAAATGTGCCATGAGTTTAACTACATCTTGATACAAACATG
ATAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000927 unedited
AGAAACTAGCGATTTTGTNAATACGNACTTCACTATAGGGNNCGGCCGCGCAATTCGGCA
CGAGGCAAGCTCAAAGAAGCAGAGGCCGCTGTTCGTTTCCTTTAGGTCTTTCCACTAAAG
TCGGAGTATCTTCTTCCAAAATTTCACGTCTTGGTGGCCGTTCCAAGGAGCGCGAGGTCG
GGATGGATCTTGAAGGGGACCGCAATGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGA
ACAATAAAAGTGAAAAAGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTCAATGT
TTCGCTATTCAAATTGGCTTGACAAGTTGTATATGGTGGTGGGAACTTTGGCTGCCATCA
TCCATGGGGCTGGACTTCCTCTCATGATGCTGGTGTTTGGAGAAATGACAGATATCTTTG
CAAATGCAGGAAATTTAGAAGATCTGATGTCAAACATCACTAATAGAAGTGATATCAATG
ATACAGGGTTCTTCATGAATCTGGAGGAAGACATGACCAGGTATGCCTATTATTACAGTG
GAATTGGTGCTGGGGTGCTGGTTGCTGCTTACATTCAGGTTTCATTTTGGTGCCTGGCAG
CTGGAAGACAAATACACAAAATTAGAAAACAGTTTTTTCATGCTATAATGCGACAGGAGA
TAGGCTGGTTTGATGTGCACGATGTTGGGGAGCTTAACACCCGACTTACAGATGATGTCT
CCAAGATTAATGAAGNGAATTGGGTGACAAATTGGAATGTTNCTTTCAGTCAATGGCAAC
ATTTTTCACTGGGTTTATAGTAGGATTTACACGTGGTTTGAAGCTACCCCTTGTGATTTT
GGCCATCAGTCCCTGTCTTGGACTGTCAACTGCTGTCTGGGCAAAGATCTATCTTCACTT
ACTGATAAAGAACTCTTAGC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000927 unedited
AATGGAACCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTATCATGTTTGT
ATCAAGATGTAGTTAAACTCATGGCACATTTTAAACATCTGTAAGTCAGAAGGATCACTT
TTGGAAGAGGCCAATTACTGGCAAAAGTGATTCATTATCAAGACAAAAAGTAAATGTACT
TTGGAAGTGTAAAAATCTTAAAAAATCCTTAAAGAACCCTTTATAAAAGCAATGCAAAGT
ATTTACTATACATCTGAATAATATGCACTTCATAATTGTGCCTCACCCCACCTCCTAAAA
TCTTATATCGATCTGTGTTTTGGGTTTGAGAGCCACCTTAATGTGGAAATGCAAGAATCA
GCAGGATCAAGTCCAAGAAGAATGAAGCCAGATGGTTCTGTAAGACCCAATGTGAATAGA
CATATACAACAGGAATTATTTAAACTGCTTAACCATTCCCACAAAAATGAGTAGGTATAT
TTAAAGAAAACTTTTTTAAAGCAGAAGTTATCTACAATATTCCAATTGAGAGAAGATATA
TTCACAGGCAGTTTGGACAAGATGACTCCAGTCACATGAAAGTTTAGTTTTATTATAGAC
ACTTTATGCAAACATTTCAATACTTTTTGCTACTTCTATAATCTTTTAGCAAGGCAGTCA
GTTACAGTCCAAATGGGAAAATATAAACAAAATTACACATTTTATCTTTTAAAATCTACT
TTAATTCTGTTATAAAATTTATAATGCAGTTTAAACTATGATTTCTCTCCACTTGATGAT
GTCTCTCACTCTGTTCCCTTAATTACGAAGTCTCTGAAGACTCTGAACTTGACTGAGGAA
TGTTAAACAGAACCTCCTCATAATCTGAAGTGTTTGCTTTTAACTTTGATAAATGTCTAT
CTAACCAAATTAAAAGTATTTACATCTATACAGTCGGAGTCACTGGCGCTTTGTTCCACC
TGGCACTGACCATTGAAAAAATGCCTTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000927
ORF Size 3843 bp
Insert Size 4900
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone has been fully sequenced and the ORF associated with this clone was found to be a perfect match to NM_000927.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000927.3, NP_000918
RefSeq Size 4872
Locus ID 5243
Cytogenetics 7q21.12
Domains ABC_membrane, ABC_tran, AAA
Protein Families ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is an ATP-dependent drug efflux pump for xenobiotic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.