BMP2 (NM_001200) Human Untagged Clone

CAT#: SC119392

BMP2 (untagged)-Human bone morphogenetic protein 2 (BMP2)

USD 639.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BMP2 (NM_001200) Human Untagged Clone
Symbol BMP2
Synonyms BDA2; BMP2A
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119392 sequence for NM_001200 edited (data generated by NextGen Sequencing)
ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGGGCGGC
GCGGCTGGCCTCGTTCCGGAGCTGGGCCGCAGGAAGTTCGCGGCGGCGTCGTCGGGCCGC
CCCTCATCCCAGCCCTCTGACGAGGTCCTGAGCGAGTTCGAGTTGCGGCTGCTCAGCATG
TTCGGCCTGAAACAGAGACCCACCCCCAGCAGGGACGCCGTGGTGCCCCCCTACATGCTA
GACCTGTATCGCAGGCACTCGGGTCAGCCGGGCTCACCCGCCCCAGACCACCGGTTGGAG
AGGGCAGCCAGCCGAGCCAACACTGTGCGCAGCTTCCACCATGAAGAATCTTTGGAAGAA
CTACCAGAAACGAGTGGGAAAACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCC
ACGGAGGAGTTTATCACCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCT
TTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCA
ACAGCCAACTCGAAATTCCCCGTGACCAGTCTTTTGGACACCAGGTTGGTGAATCAGAAT
GCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGA
CACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCC
AAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATA
AGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAA
AAACGTCAAGCCAAACACAAACAGCGGAAACGCCTTAAGTCCAGCTGTAAGAGACACCCT
TTGTACGTGGACTTCAGTGACGTGGGGTGGAATGACTGGATTGTGGCTCCCCCGGGGTAT
CACGCCTTTTACTGCCACGGAGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACT
AATCATGCCATTGTTCAGACGTTGGTCAACTCTGTTAACTCTAAGATTCCTAAGGCATGC
TGTGTCCCGACAGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTT
GTATTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGCTAG

Clone variation with respect to NM_001200.2
261 a=>g;570 a=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001200 unedited
TCTTTACCCGCCCGTTGNCGCATAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAG
CAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCG
AATTCGGCACGAGGCCCAGGATGGCTGCCCCGAGCCATGGGCCGCGGCGGAGCTAGCGCG
GAGCGCCCGACCCTCGACCCCCGAGTCCCGGAGCCGGCCCCGCGCGGGGCCACGCGTCCC
TCGGGCGCTGGTTCCTAAGGAGGACGACAGCACCAGCTTCTCCTTTCTCCCTTCCCTTCC
CTGCCCCGCACTCCTCCCCCTGCTCGCTGTTGTTGTGTGTCAGCACTTGGCTGGGGACTT
CTTGAACTTGCAGGGAGAATAACTTGCGCACCCCACTTTGCGCCGGTGCCTTTGCCCCAG
CGGAGCCTGCTTCGCCATCTCCGAGCCCCACCGCCCCTCCACTCCTCGGCCTTGCCCGAC
ACTGAGACGCTGTTCCCAGCGTGAAAAGAGAGACTGCGCGGCCGGCACCCGGGAGAAGGA
GGAGGCAAAGAAAAGGAACGGACATTCGGTCCTTGCGCCAGGTCCTTTGACCAGAGTTTT
TCCATGTGGACGCTCTTTCAATGGACGTGTCCCCGCGTGCTTCTTAGACGGACTGCGGTC
TCCTAAAGGTCGACCATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAG
GTCCTCCTGGGCGGCGCGGCTGGCCTCGTTCCGGAGCTGGGCCGCATGATGTTCGCGGCG
GCGTCGTCAGGCCGNCCCTCATCCCAGCCCTCTGACGATGTCCTGAGCGAGTTCGAGTTG
CAGCTGCTCAGCATGTTTCGCCCTGAACAGAGACCCACCCCAGCATGGACGCCGTGGNTG
CCCCCCTACATGCTAGACCTGTATCGCAAGCACTCGGGNTCAGCCGGGCTCACCCGNCCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001200 unedited
GGAAAATCAGGTACGTCGCCGCAATTCNAGATCGAGTTTTTTTTTTTTTTTTTNTCTAAA
ATATATATATATATATATATTTATGTATTTAATTTTGCTGTACTAGCGACACCCACAACC
CTCCACAACCATGTCCTGATAGTTCTTTAATACAACCTTTTCATTCTCGTCAAGGTACAG
CATCGAGATAGCACTGAGTTCTGTCGGGACACAGCATGCCTTAGGAATCTTAGAGTTAAC
AGAGTTGACCAACGTCTGAACAATGGCATGATTAGTGGAGTTCAGATGATCAGCCAGAGG
AAAAGGGCATTCTCCGTGGCAGTAAAAGGCGTGATACCCCGGGGGAGCCACAATCCAGTC
ATTCCACCCCACGTCACTGAAGTCCACGTACAAAGGGTGTCTCTTACAGCTGGACTTAAG
GCGTTTCCGCTGTTTGTGTTTGGCTTGACGTTTTTCTCTTTTGTGGAGAGGATGCCCTTT
TCCATCATGGCCAAAAGTTACTAGCAATGGCCTTATCTGTGACCAGCTGTGTTCATCTTG
GTGCAAAGACCTGCTTATCCTAACATGTCTCTTGAAGACACCTTTGTTCTCCTCCAAGTG
GGCCACTTCCACCACGAATCCATGGTTGGCGTGTCCCTGTGCAGTCCACCCGATCACAGC
GGGGGGTGACATCAAAAACTTTCCCACCCGCTTTGGATTCTGGATTCACCAACCCTGTTT
GTTCAAAAAGACTGGTCCACGGGGAAATTTCAAGTTGGCCGGTTGCAGGGTTTTAGGATT
TCATAAAATATTAATTCCGGGGAAGGAAACTGCTATTGTTTCCTAAAACATTTTGCATCT
GGTTTTCGGAAAACCGGAAACTCTGCTGGGGGGATAAACCTCCTCCGCGGGGGTAGAACC
TTAATTAAGAAAAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001200
ORF Size 1191 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001200.1, NP_001191
RefSeq Size 1547
Locus ID 650
Cytogenetics 20p12.3
Domains TGFb_propeptide, TGF-beta
Protein Families Stem cell relevant signaling - TGFb/BMP signaling pathway, Secreted Protein, ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Cancer stem cells, Embryonic stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Hedgehog signaling pathway, TGF-beta signaling pathway, Pathways in cancer, Basal cell carcinoma
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Duplication of a regulatory region downstream of this gene causes a form of brachydactyly characterized by a malformed index finger and second toe in human patients. [provided by RefSeq, Jul 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations