BMP2 (NM_001200) Human Untagged Clone

CAT#: SC119392

Reviews ()
Write a review

BMP2 (untagged)-Human bone morphogenetic protein 2 (BMP2)



  "NM_001200" in other vectors (6)

USD 680.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name BMP2 (NM_001200) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol BMP2
Synonyms BDA2; BMP2A; SSFSC
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC119392 sequence for NM_001200 edited (data generated by NextGen Sequencing)
ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGGGCGGC
GCGGCTGGCCTCGTTCCGGAGCTGGGCCGCAGGAAGTTCGCGGCGGCGTCGTCGGGCCGC
CCCTCATCCCAGCCCTCTGACGAGGTCCTGAGCGAGTTCGAGTTGCGGCTGCTCAGCATG
TTCGGCCTGAAACAGAGACCCACCCCCAGCAGGGACGCCGTGGTGCCCCCCTACATGCTA
GACCTGTATCGCAGGCACTCGGGTCAGCCGGGCTCACCCGCCCCAGACCACCGGTTGGAG
AGGGCAGCCAGCCGAGCCAACACTGTGCGCAGCTTCCACCATGAAGAATCTTTGGAAGAA
CTACCAGAAACGAGTGGGAAAACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCC
ACGGAGGAGTTTATCACCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCT
TTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCA
ACAGCCAACTCGAAATTCCCCGTGACCAGTCTTTTGGACACCAGGTTGGTGAATCAGAAT
GCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGA
CACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCC
AAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATA
AGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAA
AAACGTCAAGCCAAACACAAACAGCGGAAACGCCTTAAGTCCAGCTGTAAGAGACACCCT
TTGTACGTGGACTTCAGTGACGTGGGGTGGAATGACTGGATTGTGGCTCCCCCGGGGTAT
CACGCCTTTTACTGCCACGGAGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACT
AATCATGCCATTGTTCAGACGTTGGTCAACTCTGTTAACTCTAAGATTCCTAAGGCATGC
TGTGTCCCGACAGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTT
GTATTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGCTAG

Clone variation with respect to NM_001200.2
261 a=>g;570 a=>t
>OriGene 5' read for NM_001200 unedited
TCTTTACCCGCCCGTTGNCGCATAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAG
CAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCG
AATTCGGCACGAGGCCCAGGATGGCTGCCCCGAGCCATGGGCCGCGGCGGAGCTAGCGCG
GAGCGCCCGACCCTCGACCCCCGAGTCCCGGAGCCGGCCCCGCGCGGGGCCACGCGTCCC
TCGGGCGCTGGTTCCTAAGGAGGACGACAGCACCAGCTTCTCCTTTCTCCCTTCCCTTCC
CTGCCCCGCACTCCTCCCCCTGCTCGCTGTTGTTGTGTGTCAGCACTTGGCTGGGGACTT
CTTGAACTTGCAGGGAGAATAACTTGCGCACCCCACTTTGCGCCGGTGCCTTTGCCCCAG
CGGAGCCTGCTTCGCCATCTCCGAGCCCCACCGCCCCTCCACTCCTCGGCCTTGCCCGAC
ACTGAGACGCTGTTCCCAGCGTGAAAAGAGAGACTGCGCGGCCGGCACCCGGGAGAAGGA
GGAGGCAAAGAAAAGGAACGGACATTCGGTCCTTGCGCCAGGTCCTTTGACCAGAGTTTT
TCCATGTGGACGCTCTTTCAATGGACGTGTCCCCGCGTGCTTCTTAGACGGACTGCGGTC
TCCTAAAGGTCGACCATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAG
GTCCTCCTGGGCGGCGCGGCTGGCCTCGTTCCGGAGCTGGGCCGCATGATGTTCGCGGCG
GCGTCGTCAGGCCGNCCCTCATCCCAGCCCTCTGACGATGTCCTGAGCGAGTTCGAGTTG
CAGCTGCTCAGCATGTTTCGCCCTGAACAGAGACCCACCCCAGCATGGACGCCGTGGNTG
CCCCCCTACATGCTAGACCTGTATCGCAAGCACTCGGGNTCAGCCGGGCTCACCCGNCCC
>OriGene 3' read for NM_001200 unedited
GGAAAATCAGGTACGTCGCCGCAATTCNAGATCGAGTTTTTTTTTTTTTTTTTNTCTAAA
ATATATATATATATATATATTTATGTATTTAATTTTGCTGTACTAGCGACACCCACAACC
CTCCACAACCATGTCCTGATAGTTCTTTAATACAACCTTTTCATTCTCGTCAAGGTACAG
CATCGAGATAGCACTGAGTTCTGTCGGGACACAGCATGCCTTAGGAATCTTAGAGTTAAC
AGAGTTGACCAACGTCTGAACAATGGCATGATTAGTGGAGTTCAGATGATCAGCCAGAGG
AAAAGGGCATTCTCCGTGGCAGTAAAAGGCGTGATACCCCGGGGGAGCCACAATCCAGTC
ATTCCACCCCACGTCACTGAAGTCCACGTACAAAGGGTGTCTCTTACAGCTGGACTTAAG
GCGTTTCCGCTGTTTGTGTTTGGCTTGACGTTTTTCTCTTTTGTGGAGAGGATGCCCTTT
TCCATCATGGCCAAAAGTTACTAGCAATGGCCTTATCTGTGACCAGCTGTGTTCATCTTG
GTGCAAAGACCTGCTTATCCTAACATGTCTCTTGAAGACACCTTTGTTCTCCTCCAAGTG
GGCCACTTCCACCACGAATCCATGGTTGGCGTGTCCCTGTGCAGTCCACCCGATCACAGC
GGGGGGTGACATCAAAAACTTTCCCACCCGCTTTGGATTCTGGATTCACCAACCCTGTTT
GTTCAAAAAGACTGGTCCACGGGGAAATTTCAAGTTGGCCGGTTGCAGGGTTTTAGGATT
TCATAAAATATTAATTCCGGGGAAGGAAACTGCTATTGTTTCCTAAAACATTTTGCATCT
GGTTTTCGGAAAACCGGAAACTCTGCTGGGGGGATAAACCTCCTCCGCGGGGGTAGAACC
TTAATTAAGAAAAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001200
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001200.1, NP_001191.1
RefSeq Size 1547 bp
RefSeq ORF 1191 bp
Locus ID 650
Cytogenetics 20p12.3
Domains TGFb_propeptide, TGF-beta
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transmembrane
Protein Pathways Acute myeloid leukemia, Basal cell carcinoma, Cytokine-cytokine receptor interaction, Endocytosis, Hedgehog signaling pathway, Hematopoietic cell lineage, Melanogenesis, Pathways in cancer, TGF-beta signaling pathway
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Duplication of a regulatory region downstream of this gene causes a form of brachydactyly characterized by a malformed index finger and second toe in human patients. [provided by RefSeq, Jul 2016]

Citations (5)

Other Versions

Other products for "BMP2"
Frequently bought together (2)
Rabbit Polyclonal BMP-2 Antibody
    • 100 ul

USD 430.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools