Catalase(CAT) (NM_001752) Human Untagged Clone

CAT#: SC119081

CAT (untagged)-Human catalase (CAT)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Catalase(CAT) (NM_001752) Human Untagged Clone
Symbol CAT
Synonyms MGC138422; MGC138424
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119081 sequence for NM_001752 edited (data generated by NextGen Sequencing)
ATGGCTGACAGCCGGGATCCCGCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCC
GCGCAGAAAGCTGATGTCCTGACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAAT
GTTATTACAGTAGGGCCCCGTGGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTGATGAA
ATGGCTCATTTTGACCGAGAGAGAATTCCTGAGAGAGTTGTGCATGCTAAAGGAGCAGGG
GCCTTTGGCTACTTTGAGGTCACACATGACATTACCAAATACTCCAAGGCAAAGGTATTT
GAGCATATTGGAAAGAAGACTCCCATCGCAGTTCGGTTCTCCACTGTTGCTGGAGAATCG
GGTTCAGCTGACACAGTTCGGGACCCTCGTGGGTTTGCAGTGAAATTTTACACAGAAGAT
GGTAACTGGGATCTCGTTGGAAATAACACCCCCATTTTCTTCATCAGGGATCCCATATTG
TTTCCATCTTTTATCCACAGCCAAAAGAGAAATCCTCAGACACATCTGAAGGATCCGGAC
ATGGTCTGGGACTTCTGGAGCCTACGTCCTGAGTCTCTGCATCAGGTTTCTTTCTTGTTC
AGTGATCGGGGGATTCCAGATGGACATCGCCACATGAATGGATATGGATCACATACTTTC
AAGCTGGTTAATGCAAATGGGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCAG
GGCATCAAAAACCTTTCTGTTGAAGATGCGGCGAGACTTTCCCAGGAAGATCCTGACTAT
GGCATCCGGGATCTTTTTAACGCCATTGCCACAGGAAAGTACCCCTCCTGGACTTTTTAC
ATCCAGGTCATGACATTTAATCAGGCAGAAACTTTTCCATTTAATCCATTCGATCTCACC
AAGGTTTGGCCTCACAAGGACTACCCTCTCATCCCAGTTGGTAAACTGGTCTTAAACCGG
AATCCAGTTAATTACTTTGCTGAGGTTGAACAGATAGCCTTCGACCCAAGCAACATGCCA
CCTGGCATTGAGGCCAGTCCTGACAAAATGCTTCAGGGCCGCCTTTTTGCCTATCCTGAC
ACTCACCGCCATCGCCTGGGACCCAATTATCTTCATATACCTGTGAACTGTCCCTACCGT
GCTCGAGTGGCCAACTACCAGCGTGATGGCCCGATGTGCATGCAGGACAATCAGGGTGGT
GCTCCAAATTACTACCCCAACAGCTTTGGTGCTCCGGAACAACAGCCTTCTGCCCTGGAG
CACAGCATCCAATATTCTGGAGAAGTGCGGAGATTCAACACTGCCAATGATGATAACGTT
ACTCAGGTGCGGGCATTCTATGTGAACGTGCTGAATGAGGAACAGAGGAAACGTCTGTGT
GAGAACATTGCCGGCCACCTGAAGGATGCACAAATTTTCATCCAGAAGAAAGCGGTCAAG
AACTTCACTGAGGTCCACCCTGACTACGGGAGCCACATCCAGGCTCTTCTGGACAAGTAC
AATGCTGAGAAGCCTAAGAATGCGATTCACACCTTTGTGCAGTCCGGATCTCACTTGGCG
GCAAGGGAGAAGGCAAATCTGTGA

Clone variation with respect to NM_001752.3
1167 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001752 unedited
GGTTGNAATTTGTATACGACTCACTATAGGGCGGCCGCGCAATTCGCACGAGGACGAGCC
GAGGCCTCCTGCAGTGTTCTGCACAGCAAACCGCACGCTATGGCTGACAGCCGGGATCCC
GCCAGCGACCAGATGCAGCACTGGAAGGAGCAGCGGGCCGCGCAGAAAGCTGATGTCCTG
ACCACTGGAGCTGGTAACCCAGTAGGAGACAAACTTAATGTTATTACAGTAGGGCCCCGT
GGGCCCCTTCTTGTTCAGGATGTGGTTTTCACTGATGAAATGGCTCATTTTGACCGAGAG
AGAATTCCTGAGAGAGTTGTGCATGCTAAAGGAGCAGGGGCCTTTGGCTACTTTGAGGTC
ACACATGACATTACCAAATACTCCAAGGCAAAGGTATTTGAGCATATTGGAAAGAAGACT
CCCATCGCAGTTCGGTTCTCCACTGTTGCTGGAGAATCGGGTTCAGCTGACACAGTTCGG
GACCCTCGTGGGTTTGCAGTGAAATTTTACACAGAAGATGGTAACTGGGATCTCGTTGGA
AATAACACCCCCATTTTCTTCATCAGGGATCCCATATTGTTTCCATCTTTTATCCACAGC
CAAAAGAGAAATCCTCAGACACATCTGAAGGATCCGGACATGGTCTGGGACTTCTGGAGC
CTACGTCCTGAGTCTCTGCATCACGTTTCTTTCTTGTTCAGTGATCCGGGGATTCCAGAT
GGACATCGCCACATGAATGGATATGGATCACATACTCTCCAGCCTGTTTAATGCCAAATG
GGGAGGCAGTTTATTGCAAATTCCATTATAAGACTGACCACGGCATCAAAAACCTTTCTG
TTGAAGATCCGGCGAGACTTTCCCANGAAGAATCTGACTATGGCATCCGGGGATCTTTTT
ACCGCCATTGCCCCAGNAAAGTCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001752 unedited
NNNTTTTTAGCTATGGACCCGCGGCCGCAATCTAGNGTCGAGTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTACGGACAGATTATTTATTGGAAAAATGTAAGCAATTACA
AATTGATCTGTTGGGAAATCAGGGCTGAATTAACATTAATGTAACTCCAGGGAAAAAAAT
GAATTTGATCAATTATTATCATTAATAAACATTAAGCCATGACGGGGCTCAAGTTATCTT
CTGATGACACTGCTGTATTAAATGTACTTTTCCTATGAAAACCTTAAAAAAATAAAAATT
TCTGAGGAAAACATCTTTATCTTTTCTTTTTATATATTTATAGCCATATTTTAATATAAT
AGGCCATGAGGGGATATGTAAACATACATAATTTCAACAAATTTTGTCAAATAAAATCAT
ATTTCTAGCTAGAAACTTGCCTTCTAATCATTTTAAATGAATAATCCAATCATCCGTCAA
AACAAATTTTTTTTTTAAATGACTGTTAAATCCTAACCTTCATTTTCCCCTGGGGAAATA
GCATTAAAATTGTTACACAATCTGCTATAGAAAGTGGGATTCTCTATTTTGAAGCCACTA
GCTTGCATTTGCACATCTAGCACAGGAGAATCTTCATCCAGTGATGAGCGGGTTACACCG
GATGAACGCTAAGCTTCGCTGCACAGGTGCAGGGCCCCGGCCTCACAGATTTGCCTTCTC
CCTTGCCGCCAAGTGAGATCCGGACTGCACAAAGGTGTGAATCGCATTCTAAGGCTTTTC
AGCATTGCACTTGCCCAAAAAGCCTGAATGTGCCTCCCGTATCCAGGTGGACCTCAGTGA
AGTCTTGACCGTTTTCTCTGGAAGAAAATTTGGCATCCTTCAGGTGCCCGCAATGTTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001752
ORF Size 1584 bp
Insert Size 2150
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001752.2, NP_001743
RefSeq Size 2305
RefSeq ORF 1584
Locus ID 847
Cytogenetics 11p13
Domains catalase
Protein Families Druggable Genome
Protein Pathways Tryptophan metabolism, Methane metabolism, Metabolic pathways, Amyotrophic lateral sclerosis (ALS)
Gene Summary This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations