MDM2 (NM_002392) Human Untagged Clone

CAT#: SC118660

MDM2 (untagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2

USD 794


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MDM2 (NM_002392) Human Untagged Clone
Symbol MDM2
Synonyms ACTFS; hdm2; HDMX
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002392 edited
AGGGCGTCGTGCTTCCGCGCGCCCCGTGAAGGAAACTGGGGAGTCTTGAGGGACCCCCGA
CTCCAAGCGCGAAAACCCCGGATGGTGAGGAGCAGGCAAATGTGCAATACCAACATGTCT
GTACCTACTGATGGTGCTGTAACCACCTCACAGATTCCAGCTTCGGAACAAGAGACCCTG
GTTAGACCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGACACT
TATACTATGAAAGAGGTTCTTTTTTATCTTGGCCAGTATATTATGACTAAACGATTATAT
GATGAGAAGCAACAACATATTGTATATTGTTCAAATGATCTTCTAGGAGATTTGTTTGGC
GTGCCAAGCTTCTCTGTGAAAGAGCACAGGAAAATATATACCATGATCTACAGGAACTTG
GTAGTAGTCAATCAGCAGGAATCATCGGACTCAGGTACATCTGTGAGTGAGAACAGGTGT
CACCTTGAAGGTGGGAGTGATCAAAAGGACCTTGTACAAGAGCTTCAGGAAGAGAAACCT
TCATCTTCACATTTGGTTTCTAGACCATCTACCTCATCTAGAAGGAGAGCAATTAGTGAG
ACAGAAGAAAATTCAGATGAATTATCTGGTGAACGACAAAGAAAACGCCACAAATCTGAT
AGTATTTCCCTTTCCTTTGATGAAAGCCTGGCTCTGTGTGTAATAAGGGAGATATGTTGT
GAAAGAAGCAGTAGCAGTGAATCTACAGGGACGCCATCGAATCCGGATCTTGATGCTGGT
GTAAGTGAACATTCAGGTGATTGGTTGGATCAGGATTCAGTTTCAGATCAGTTTAGTGTA
GAATTTGAAGTTGAATCTCTCGACTCAGAAGATTATAGCCTTAGTGAAGAAGGACAAGAA
CTCTCAGATGAAGATGATGAGGTATATCAAGTTACTGTGTATCAGGCAGGGGAGAGTGAT
ACAGATTCATTTGAAGAAGATCCTGAAATTTCCTTAGCTGACTATTGGAAATGCACTTCA
TGCAATGAAATGAATCCCCCCCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAG
AATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTG
GAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTG
AATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAA
TCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGC
CAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAAGACAAAGAAGAGAGTGTGGAA
TCTAGTTTGCCCCTTAATGCCATTGAACCTTGTGTGATTTGTCAAGGTCGACCTAAAAAT
GGTTGCATTGTCCATGGCAAAACAGGACATCTTATGGCCTGCTTTACATGTGCAAAGAAG
CTAAAGAAAAGGAATAAGCCCTGCCCAGTATGTAGACAACCAATTCAAATGATTGTGCTA
ACTTATTTCCCCTAGTTGACCTGTCTATAAGAGAATTATATATTTCTAACTATATAACCC
TAGGAATTTAGACCACCTGAAATTTATTCACATATATCAAAGTGAGAAAATGCCT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002392 unedited
GCAACGCAATTCGCACGAGCCTCCCCGGATTAGTGCGTACGAGCGCCCAGTGCCCTGGCC
CGGAGAGTGGAATGATCCCCGAGGCCCAGGGCGTCGTGCTTCCGCGCGCCCCGTGAAGGA
AACTGGGGAGTCTTGAGGGACCCCCGACTCCAAGCGCGAAAACCCCGGATGGTGAGGATC
AGGTAAATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTAACCACCTCACAG
ATTCCAGCTTCGGAACAAGAGACCCTGGTTAGACCAAAGCCATTGCTTTTGAAGTTATTA
AAGTCTGTTGGTGCACAAAAAGACACTTATACTATGAAAGAGGTTCTTTTTTATCTTGGC
CAGTATATTATGACTAAACGATTATATGATGAGAAGCAACAACATATTGTATATTGTTCA
AATGATCTTCTAGGAGATTTGTTTGGCGTGCCAAGCTTCTCTGTGAAAGAGCACAGGAAA
ATATATACCATGATCTACAGGAACTTGGTAGTAGTCAATCAGCAGGAATCATCGGACTCA
GGTACATCTGTGAGTGAGAACAGGTGTCACCTTGAAAGTGGGAGTGATCAAAAGGACCTT
GTACAAGAGCTTCANGAAGAGAAACCTTCATCTTCACATTTGGTTTCTAGACCATCTACC
TCATCTAGAAAGGAGAGCCATTAGTGAGACAGAAGAAAATTCATATGAATTATCTGGTGA
ACGACCAAANAAAGCGCCCCAAACCTGATAGTATTTCCCTTTCCTTTTGTGAAAAGCCTG
CCTCTGTGTGGTAAAAAGGGAGATATGTTGGGAAAAGAAGCATTANCCGTGGAATCTACA
GGGCCCCCATTCGAATCCGGATCTTGATGCCTGGGGTAAAGGAAA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002392 unedited
AAAANTTTGACTCTGGACCCGCGGCCGCATNCTANGATCGAGTTTTTTTTTTTTTTAAAT
AAGTTACATTTAAATGTCATATACACTATTTAAGAAAAAAAAAAACCAGTACTTCTCATT
TAAGACAGAGTAGAAATTATTTAAAATTAGGAGTTGGTGTAAAGGATGAGCTACATATTC
AAGTCAAATTATAGTAAGTATTCACTATTCCACTACCAAAGTAGGTCAATTATACTAAAG
AGAAGAAATCTATGTGAATTGAGGCATTTTCTCACTTTGATATATGTGAATAAATTTCAG
GTTGTCTAAATTCCTAGGGTTATATAGTTAGAAATATATAATTCTCTTATAGACAGGTCA
ACTAGGGGAAATAAGTTAGCACAATCATTTGAATTGGTTGTCTACATACTGGGCAGGGCT
TATTCCTTTTCTTTAGCTTCTTTGCACATGTAAAGCAGGCCATAAGATGTCCTGTTTTGC
CATGGACAATGCAACCATTTTTAGGTCGACCTTGACAAATCACACAAGGTTCAATGGCAT
TAAGGGGCAAACTAGATTCCACACTCTCTTCTTTGTCTTGGGTTTCTTCCCTTTCAAACT
CTTTCACATCTTCTTGGCTGCTATAAATAATGCTACTAGAAGTTGATGGCTGAGAATAGT
CTTCACTTTCTTGTGATTGTGAAGCTGNGTAATTTTATCATCATTTTCCTCACACATGAC
TCTCTGGATCATCACTATAGGTTTTTTACATCACGAACTCAAAGCCTCTTCAGCTTGGGT
GAGTTTCCAGTTGGCTTTTTAGAAATTCCCCTTATCTTTCCCTTTATCTCAGGAGCCCAT
TTCACCAAGGCCCAACATTTTGCATTTGTGGAAAGGGGGGAATCTTCATTGCTGAAAGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002392
ORF Size 1494 bp
Insert Size 1800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002392.2, NP_002383
RefSeq Size 2357
RefSeq ORF 1494
Locus ID 4193
Cytogenetics 12q15
Domains zf-RanBP, MDM2
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Cell cycle, p53 signaling pathway, Ubiquitin mediated proteolysis, Endocytosis, Pathways in cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia
Gene Summary This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations