PD1 (PDCD1) (NM_005018) Human Untagged Clone

CAT#: SC117011

Reviews ()
Write a review

PD-1 / PDCD1 (untagged)-Human programmed cell death 1 (PD-1 / PDCD1)



Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product images

Other products for "PDCD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDCD1
Synonyms CD279; hPD-1; hPD-l; hSLE1; PD-1; PD1; SLEB2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005018 edited
GAATTCGGCACGAGGTGGAGAAGGCGGCACTCTGGTGGGGCTGCTCCAGGCATGCAGATC
CCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGGCCAGGATGG
TTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTG
GTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTC
GTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCC
GAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGG
CGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGT
GGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGG
GTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAGGCCAGCC
GGCCAGTTCCAAACCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTG
CTAGTCTGGGTCCTGGCCGTCATCTGCTCCCGGGCCGCACGAGGGACAATAGGAGCCAGG
CGCACCGGCCAGCCCCTGAAGGAGGACCCCTCAGCCGTGCCTGTGTTCTCTGTGGACTAT
GGGGAGCTGGATTTCCAGTGGCGAGAGAAGACCCCGGAGCCCCCCGTGCCCTGTGTCCCT
GAGCAGACGGAGTATGCCACCATTGTCTTTCCTAGCGGAATGGGCACCTCATCCCCCGCC
CGCAGGGGCTCAGCCGACGGCCCTCGGAGTGCCCAGCCACTGAGGCCTGAGGATGGACAC
TGCTCTTGGCCCCTCTGACCGGCTTCCTTGGCCACCAGTGTTCTGCAGACCCTCCACCAT
GAGCCCGGGTCAGCGCATTTCCTCAGGAGAAGCAGGCAGGGTGCAGGCCATTGCAGGCCG
TCCAGGGGCTGAGCTGCCTGGGGGCGACCGGGGCTCCAGCCTGCACCTGCACCAGGCACA
GCCCCACCACAGGACTCATGTCTCAATGCCCACAGTGAGCCCAGGCAGCAGGTGTCACCG
TCCCCTACAGGGAGGGCCAGATGCAGTCACTGCTTCAGGTCCTGCCAGCACAGAGCTGCC
TGCGTCCAGCTCCCTGAATCTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCCTGCGGCC
CGGGGCTGAAGGCGCCGTGGCCCTGCCTGACGCCCCGGAGCCTCCTGCCTGAACTTGGGG
GCTGGTTGGAGATGGCCTTGGAGCAGCCAAGGTGCCCCTGGCAGTGGCATCCCGAAACGC
CCTGGACGCAGGGCCCAAGACTGGGCACAGGAGTGGGAGGTACATGGGGCTGGGGACTCC
CCAGGAGTTATCTGCTCCCTGCAGGCCTAGAGAAGTTTCAGGGAAGGTCAGAAGAGCTCC
TGGCTGTGGTGGGCAGGGCAGGAAACCCCTCCACCTTTACACATGCCCAGGCAGCACCTC
AGGCCCTTTGTGGGGCAGGGAAGCTGAGGCAGTAAGCGGGCAGGCAGAGCTGGAGGCCTT
TCAGGCCCAGCCAGCACTCTGGCCTCCTGCCGCCGCATTCCACCCCAGCCCCTCACACCA
CTCGGGAGAGGGACATCCTACGGTCCCAAGGTCAGGAGGGCAGGGCTGGGGTTGACTCAG
GCCCCTCCCAGCTGTGGCCACCTGGGTGTTGGGAGGGCAGAAGTGCAGGCACCTAGGGCC
CCCCATGTGCCCACCCTGGGAGCTCTCCTTGGAACCCATTCCTGAAATTATTTAAAGGGG
TTGGCCGGGCTCCCACCAGGGCCTGGGTGGGAAGGTACAGGCGTTCCCCCGGGGCCTAGT
ACCCCCGCCGTGGCCTATCCACTCCTCACATCCACACACTGCACCCCCACTCCTGGGGCA
GGGCCACCAGCATCCAGGCGGCCAGCAGGCACCTGAGTGGCTGGGACAAGGGATCCCCCT
TCCCTGTGGTTCTATTATATTATAATTATAATTAAATATGAGAGCATGCCAAAAAAAAAA
AAAAAAAACTCGAC
>OriGene 5' read for NM_005018 unedited
GCATTTTGTAATACGAACTCACTATAGGGCGGCCGCGAATTCGCACGAGGTGGAGAAGGC
GGCACTCTGGTGGGGCTGCTCCAGGCATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCT
GGGCGGTGCTACAACTGGGCTGGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCT
GGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCT
TCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCC
CCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGG
ACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCA
GGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGG
CGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGC
CCACAGCCCACCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTGGTTG
GTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTGCTAGTCTGGGTCCTGGCCGTCATCT
GCTCCCGGGCCGCACGAGGGACAATAGGAGCCAGGCGCACCGGCCAGCNCCCTGAAGAGG
ACCCCTCAGCCGTGCCTGTGTTCTCTGTGGACTATGGGGAGCTGGATTTCCAGTGGCGAG
AGAAGACCCCGGACCCCCCGTGCCCTGTGTCCCTGAGCAGACGGAGTATGCCACCATTGT
CTTTCCTAGCGGAATGGGCACCTCATNCNCCGCCCGCAGGGGCTCAGCCGACGGCCCTCG
GAGTGCCCAGCCCTGAGGCCTGAGATGGACCTGCTCTTGCCCTCTGACGGCTNCTGGCCC
CAGGT
>OriGene 3' read for NM_005018 unedited
CGCGGCCGCAATTTAGNATCGAGTTTTTTTTTTTTTTTTTTGGCATGCTCTCATATTTAA
TTATAATTATAATATAATAGAACCACAGGGAAGGGGGATCCCTTGTCCCAGCCACTCAGG
TGCCTGCTGGCCGCCTGGATGCTGGTGGCCCTGCCCCAGGAGTGGGGGTGCAGTGTGTGG
ATGTGAGGAGTGGATAGGCCACGGCGGGGGTACTAGGCCCCGGGGGAACGCCTGTACCTT
CCCACCCAGGCCCTGGTGGGAGCCCGGCCAACCCCTTTAAATAATTTCAGGAATGGGTTC
CAAGGAGAGCTCCCAGGGTGGGCACATGGGGGGCCCTAGGTGCCTGCACTTCTGCCCTCC
CAACACCCAGGTGGCCACAGCTGGGAGGGGCCTGAGTCAACCCCAGCCCTGCCCTCCTGA
CCTTGGGACCGTAGGATGTCCCTCTCCCGAGTGGTGTGAGGGGCTGGGGTGGAATGCGGC
GGCAGGAGGCCAGAGTGCTGGCTGGGCCTGAAAGGCCTCCAGCTCTGCCTGCCCGCTTAC
TGCCTCAGCTTTCCTGCCCCACAAAGGGCCTGAGGTGCTGCCTGGGCATGTGTAAAGGTG
GAGGGGTTTCCTGCCCTGCCCACCACAGCCAGGAGCTCTTCTGACCTTTCCTGAAACTTC
TCTAGGCCTGCAGGGAGCAGATAACTTCTGGGGAGTCCCCAGCCCCATTGTCCTTCCAAT
TCTGTGCCCAGTCTTGGGCCCTGCGCCCAGGGCGTTTTGGGATGCCCCTGCCCGGGGCCC
CTTTGCTGGTCCAAGCCATTTCCAACCAACCCCAAGTTCAGCAGGAAGTTCCGGGCGTAA
GGAAGGGCCCGCGCCTTTAACCCCGGCCCCATGCACTACTACATCATATCATCAGTTCCG
AGTATATGGAGCTGGCCCCAGCACTTTTTGTCTGCAGGACTCGAAACAT
Restriction Sites NotI-NotI     
ACCN NM_005018
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005018.1, NP_005009.1
RefSeq Size 2106 bp
RefSeq ORF 867 bp
Locus ID 5133
UniProt ID Q15116
Cytogenetics 2q37.3
Domains ig, IGv, IG
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), T cell receptor signaling pathway
Gene Summary Programmed cell death protein 1 (PDCD1) is an immune-inhibitory receptor expressed in activated T cells; it is involved in the regulation of T-cell functions, including those of effector CD8+ T cells. In addition, this protein can also promote the differentiation of CD4+ T cells into T regulatory cells. PDCD1 is expressed in many types of tumors including melanomas, and has demonstrated to play a role in anti-tumor immunity. Moreover, this protein has been shown to be involved in safeguarding against autoimmunity, however, it can also contribute to the inhibition of effective anti-tumor and anti-microbial immunity. [provided by RefSeq, Aug 2020]
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.