UFM1 (NM_016617) Human Untagged Clone

SKU
SC114161
UFM1 (untagged)-Human ubiquitin-fold modifier 1 (UFM1)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UFM1
Synonyms BM-002; C13orf20; HLD14
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC114161 sequence for NM_016617 edited (data generated by NextGen Sequencing)
ATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAGTA
CTCAGTGTTCCTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAATTT
AAAGTTCCTGCTGCAACAAGTGCAATTATTACCAATGATGGAATAGGAATAAATCCTGCA
CAGACTGCTGGAAATGTTTTTCTAAAACATGGTTCAGAACTGCGGATTATTCCTAGAGAT
CGTGTTGGAAGTTGTTAA

Clone variation with respect to NM_016617.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016617 unedited
GCGGCCGCGAATTCGGCACCAGGCGGAGTTGTCGTGTGTTCTGGATTCATTCCGGCACCA
CCATGTCGAAGGTTTCCTTTAAGATCACGCTGACGTCGGACCCACGGCTGCCGTACAAAG
TACTCAGTGTTCCTGAAAGTACACCTTTCACAGCAGTCTTAAAGTTTGCAGCAGAAGAAT
TTAAAGTTCCTGCTGCAACAAGTGCAATTATTACCAATGATGGAATAGGAATAAATCCTG
CACAGACTGCTGGAAATGTTTTTCTAAAACATGGTTCAGAACTGCGGATTATTCCTAGAG
ATCGTGTTGGAAGTTGTTAATATCTGCTACTTGGAACATACGATTGCCTTTCAGAATAAA
TATTGGTATTTTTTGTTGTTGTAAAATTGAAATCAGGCATTTAACATACTATGAAAACAC
CAGGAGTCAATGATTAATGAAAGGTGACTCATCTGTCCCTTTTTGTTGTCCATACTCTTC
CTATGAAGAGGGAATGCGTATGAATTAAGGCTACTACTGTCACAGAAGATCATAGTCTTT
GATGCTACCTCACACACAAACAGGTAGTTCGTTGGGGGCAAATGAATTAGCCAACTGTTA
ACTGGAAGCTTTTGATAATTTTTTTTTTTAGAACAATNTGGAACATTAAAATTTACTGAA
TCGTATATATTCATCTGAGATAAAAATTAAAAAGAATTATGGACCCTGGATGGGCANTTG
CTTGATAGCATCTG
Restriction Sites NotI-NotI
ACCN NM_016617
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016617.1, NP_057701.1
RefSeq Size 2529 bp
RefSeq ORF 258 bp
Locus ID 51569
UniProt ID P61960
Cytogenetics 13q13.3
Domains UPF0185
Summary UFM1 is a ubiquitin-like protein that is conjugated to target proteins by E1-like activating enzyme UBA5 (UBE1DC1; MIM 610552) and E2-like conjugating enzyme UFC1 (MIM 610554) in a manner analogous to ubiquitylation (see UBE2M; MIM 603173) (Komatsu et al., 2004 [PubMed 15071506]).[supplied by OMIM, Dec 2008]
Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:UFM1 (NM_016617) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202665 UFM1 (Myc-DDK-tagged)-Human ubiquitin-fold modifier 1 (UFM1) 10 ug
$150.00
RC202665L1 Lenti ORF clone of Human ubiquitin-fold modifier 1 (UFM1), Myc-DDK-tagged 10 ug
$450.00
RC202665L2 Lenti ORF clone of Human ubiquitin-fold modifier 1 (UFM1), mGFP tagged 10 ug
$450.00
RC202665L3 Lenti ORF clone of Human ubiquitin-fold modifier 1 (UFM1), Myc-DDK-tagged 10 ug
$450.00
RC202665L4 Lenti ORF clone of Human ubiquitin-fold modifier 1 (UFM1), mGFP tagged 10 ug
$450.00
RG202665 UFM1 (tGFP-tagged) - Human ubiquitin-fold modifier 1 (UFM1) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.