c-Myc (MYC) (NM_002467) Human Untagged Clone

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name c-Myc (MYC) (NM_002467) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol MYC
Synonyms bHLHe39; c-Myc; MRTL; MYCC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002467 edited
ATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAG
CCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTG
CAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCC
CTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTC
TCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAG
ATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGAC
GACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCC
GCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGC
AGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGAT
CTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAAC
GACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCG
GATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTC
CATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAA
GAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGA
TCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGC
CACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCT
GCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGA
AAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAAC
GTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAG
ATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACA
GCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTG
CGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAA
>OriGene 5' read for NM_002467 unedited
TAGATTTCTGTACACGATTCACTATAGGGCGGCCGCGCAATTCGCACGAGGCGGCTAGGG
TGGAAGAGCCGGGCGAGCAGAGCTGCGCTGCGGGCGTCCTGGGAAGGGAGATCCGGAGCG
AATAGGGGGCTTCGCCTCTGGCCCAGCCCTCCCGCTGATCCCCCAGCCAGCGGTCCGCAA
CCCTTGCCGCATCCACGAAACTTTGCCCATAGCAGCGGGCGGGCACTTTGCACTGGAACT
TACAACACCCGAGCAAGGACGCGACTCTCCCGACGCGGGGAGGCTATTCTGCCCATTTGG
GGACACTTCCCCGCCGCTGCCAGGACCCGCTTCTCTGAAAGGCTCTCCTTGCAGCTGCTT
AGACGCTGGATTTTTTTCGGGTAGTGGAAAACCAGCCTCCCGCGACGATGCCCCTCAACG
TTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACT
GCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCCAGAGCGAGCTGCAGCCCCCGGCG
CCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGC
CGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGA
GACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGTAGATGGTGACCGAG
CTGCTGCGAGGAGACATGCTGAACCACAGTTTCATCTGCGACCCGGACGACGAGACCTTC
ATCAAAAACATCATCATCCAGGACTGTATGTGGGAGCGGCTTTTTCGGCGCCGCCAAGCT
CGTCTCAGAGAGCTGGGCCTCTACAGGGCTGAGCGCAAGACAGAGGNAGACCGAACCCGC
CCGCGGGCCCAGNGTCTGCTCCACCTCCACTTGTACTGCAGTATCTGACGCCGCGCTCAC
ATGCAT
>OriGene 3' read for NM_002467 unedited
TACTTTGGACCCGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTATATTTGC
CAGTTATTTTATTTTTTCTAAAAACAATAGAAAAAATCAACTTTAAAAAGCAAAATGTAC
TTAAATAAAAAAAATTAGGGTTTATAGTACCTATAATACTAGGTACTATATACTAGGATT
GAAATTCTGTGTAACTGCTATAAACGTTTTNATTAAAGTTNTATTTACATTTAATGGCAA
TATTTACAGAGAAACATTGTGTAAATCTTAAAATTTTTTAAAAACAATTCTTAAATACAA
ATCTGTTAAAGAAAAAAAAAAGATGGTAAGCATAAAAAAGTTCTTTTATGCCCAAAGTCC
AATTTGAGGCAGTTTACATTATGGCTAAATCTTTCAGTCTCAAGACTCAGCCAAGGTTGT
GAGGTTGCATTTGATCATGCATTTGAAACAAGTTCATAGGTGATTGCTCANGACATTTCT
GTTAGAAGGAAATCGTTTCCTTACTTTTCCTTACGCACAAAGAGTCCGTAGCTGTTCAAG
TTTGTGTTTCAACTGTTCTCGTCGTTTCCGCAACAAGTCCTCTTCAGAAATGAGCTTTTG
CTCCTCTGCTTGNACGGACAGGATGTATGCTGTGGNCTTTTTAANGGATAACTACCTTNG
GGGGNCCCTTTCATGNTTTCCAACTNCCGGATCTGGTCACGCAGGGCAAAAAAGCTNCGT
TTTAACTCGTTTCTTCTCTGGCGCTNCAAGACGTTGGGTGTTCGCCTCTTGACATTCTCC
TCGGTGTCCGAAGACCTGGGGNCTGTGCATTTTCCGGTGGTGCTGATCTGCTTAAGACTT
TGACACTGTCAACTTGACCCTTTTGCAACAGAAAGTCCTTCGAATGAAGGGAGCCCTGCC
TAATTGCCTAATGTTGGAAACTGGGCACTCTTGAGAACAAGGGCCTTAAGAGGTTTTCTG
GGCCTCACCAAAAGGAACCAACTTTGCCCTTTGCCAAAC
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_002467
ORF Size 1365 bp
Insert Size 2100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002467.3, NP_002458.2
RefSeq Size 2377
RefSeq ORF 1365
Locus ID 4609
Cytogenetics 8q24.21
Domains HLH, Myc_N_term, Myc-LZ
Protein Families Druggable Genome, Embryonic stem cells, Induced pluripotent stem cells, Stem cell - Pluripotency, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - TGFb/BMP signaling pathway, Stem cell relevant signaling - Wnt Signaling pathway, Transcription Factors
Protein Pathways Acute myeloid leukemia, Bladder cancer, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Pathways in cancer, Small cell lung cancer, TGF-beta signaling pathway, Thyroid cancer, Wnt signaling pathway
Gene Summary This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]

Citations (4)

Other Versions

Frequently bought together (2)
9E10, Anti-Myc Monoclonal Antibody
    • 100 ul

USD 299.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones