Fbxl15 (NM_001107603) Rat Untagged Clone

SKU
RN206667
Fbxl15 (untagged ORF) - Rat F-box and leucine-rich repeat protein 15 (Fbxl15), (10 ug)
$330.00
5 Weeks*
Specifications
Product Data
Type Rat Untagged Clone
Target Symbol Fbxl15
Synonyms RGD1306444
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>RN206667 representing NM_001107603
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCCACCAATGGAGCAGTCCGGAGGGGAGCAAGAACCAGGAGCCGTCAGGCTCCTGGACCTGCCCT
GGGAAGACGTGCTGCTCCCGCACGTCCTGAACTGGGTCCCGCTGCGCCAGCTGCTCCGGCTGCAGCGCGT
CAGTCGCGCCTTCCGGGCGCTCGTTCAGCTGCACCTGGCTAGGCTGCGCCGCTTTGACGCCGCTCAGGTG
GGTCCACAGATTCCACGGGCCGCACTAGTCCGGCTACTGCGAGATGCTGAGGGGTTGCAGGAGCTGGCGC
TGGCTCCGTGTCACGAATGGCTGTTGGACGAGGACCTGGTGCCGGTGCTGGCACGGAATCCACAGCTACG
GAGCGTAGCACTGGCCGGCTGCGGCCAACTGAGTCGCCGAGCACTCGGAGCGCTGGCTGAGGGCTGCCCG
CGTCTGCAGCGCATTTCGCTCGCTCACTGTGACTGGGTGGACGGGCTGGCACTGCGTGGCCTTGCTGACC
GCTGCCCGGCTCTGGAGGAGCTAGACCTCACCGCCTGTCGTCAACTCAAGGACGAGGCCATCGTGTACCT
GGCGCAGAGACGCGGCGCGGGCCTCCGCAGCCTCTCGTTGGCAGTCAACGCCAATGTGGGGGACACCGCG
GTCCAAGAGTTGGCTCGAAACTGCCCGCAACTCGAGCACCTAGACCTCACCGGCTGCCTTCGGGTCGGAA
GCGACGGTGTCAGGACACTGGCGGAGTACTGCCCGGCGTTGCGCTCTCTGCGGGTGCGGCACTGCCACCA
TGTGGCCGAGCCCAGCCTGAGCCGCTTGCGGAAGCGTGGTGTGGACATCGACGTGGAGCCACCGCTGCAC
CAGGCCCTGGTGCTACTCCAGGACATGGCTGGCTTCGCACCCTTTGTCAACCTACAGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_001107603
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001107603.1, NP_001101073.1
RefSeq Size 1346 bp
RefSeq ORF 903 bp
Locus ID 309453
UniProt ID D4ABB4
Cytogenetics 1q54
Summary Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of SMURF1, thereby acting as a positive regulator of the BMP signaling pathway. Required for dorsal/ventral pattern formation. Also mediates ubiquitination of SMURF2 and WWP2 (By similarity). Required for bone mass maintenance.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Fbxl15 (NM_001107603) Rat Untagged Clone
Your Rating
SKU Description Size Price
RR206667 Fbxl15 (Myc-DDK-tagged ORF) - Rat F-box and leucine-rich repeat protein 15 (Fbxl15), (10 ug) 10 ug
$330.00
RR206667L3 Lenti ORF clone of Fbxl15 (Myc-DDK-tagged ORF) - Rat F-box and leucine-rich repeat protein 15 (Fbxl15), (10 ug) 10 ug
$630.00
RR206667L4 Lenti ORF clone of Fbxl15 (mGFP-tagged ORF) - Rat F-box and leucine-rich repeat protein 15 (Fbxl15), (10 ug) 10 ug
$630.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.