RAC2 (NM_002872) Human Tagged ORF Clone
SKU
RG200304
RAC2 (tGFP-tagged) - Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2)
-
TrueORF®
TrueORF®
Expression-ready ORF plasmid with C-terminal tag(s)
Click here to learn more.
Product Data | |
Type | Human Tagged ORF Clone |
---|---|
Target Symbol | RAC2 |
Synonyms | EN-7; Gx; HSPC022; IMD73A; IMD73B; IMD73C; p21-Rac2 |
Vector | pCMV6-AC-GFP |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
ORF Nucleotide Sequence
>RG200304 representing NM_002872
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGATGGGGCCGTGGGCAAGACCTGCCTTCTCATCAGCTACA CCACCA ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Protein Sequence
>RG200304 representing NM_002872
Red=Cloning site Green=Tags(s) MQAIKCVVVGDGAVGKTCLLISYTT TRTRPLE - GFP Tag - V |
Chromatograms |
Chromatograms
![]() Sequencher program is needed, download here |
Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
Plasmid Map
![]() |
ACCN | NM_002872 |
ORF Size | 76 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_002872.3, NP_002863.1 |
RefSeq Size | 1516 bp |
RefSeq ORF | 579 bp |
Locus ID | 5880 |
UniProt ID | P15153 |
Cytogenetics | 22q13.1 |
Domains | RAB, RAN, ras, RAS, RHO |
Protein Families | Druggable Genome |
Protein Pathways | Adherens junction, Axon guidance, B cell receptor signaling pathway, Chemokine signaling pathway, Colorectal cancer, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Leukocyte transendothelial migration, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Pancreatic cancer, Pathways in cancer, Regulation of actin cytoskeleton, VEGF signaling pathway, Viral myocarditis, Wnt signaling pathway |
Summary | This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC200304 | RAC2 (Myc-DDK-tagged)-Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) | 10 ug |
$289.00
MSRP
$450.00
MSRP
$450.00
|
|
RC200304L1 | Lenti-ORF clone of RAC2 (Myc-DDK-tagged)-Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) | 10 ug |
$750.00
|
|
RC200304L2 | Lenti-ORF clone of RAC2 (mGFP-tagged)-Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) | 10 ug |
$750.00
|
|
RC200304L3 | Lenti-ORF clone of RAC2 (Myc-DDK-tagged)-Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) | 10 ug |
$750.00
|
|
RC200304L4 | Lenti-ORF clone of RAC2 (mGFP-tagged)-Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) | 10 ug |
$750.00
|
|
SC118358 | RAC2 (untagged)-Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2) | 10 ug |
$450.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.