LCK (NM_005356) Human Tagged ORF Clone

SKU
RC219375
LCK (Myc-DDK-tagged)-Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2
  • TrueORF Gold

    Protein expression verified by Western blot, fully sequenced and in stock

    Click here to learn more.

$711.00
In Stock*
Specifications
Product Data
Type Human Tagged ORF Clone
Target Symbol LCK
Synonyms IMD22; LSK; p56lck; pp58lck; YT16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
ORF Nucleotide Sequence
>RG219375 representing NM_005356
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGTGAGAACTGCC
ATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAATGGCTCTGAGGTGCGGGACCC
ACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCACTGCAAGACAACCTGGTTATCGCTCTGCAC
AGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTTGAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGA
GCGGCGAGTGGTGGAAGGCGCAGTCCCTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGC
CAAAGCGAACAGCCTGGAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAG
CTCCTGGCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGATCGTTTT
CACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAGATCCGTAATCTGGA
CAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTGCATGAACTGGTCCGCCATTACACC
AATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGCCCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGT
GGGAGGACGAGTGGGAGGTTCCCAGGGAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGG
GGAGGTGTGGATGGGGTACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATG
TCCCCGGACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTGGTTCGGCTCT
ACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAATGGGAGTCTAGTGGATTT
TCTCAAGACCCCTTCAGGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAA
GGCATGGCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATTCTGGTGTCTG
ACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGACAACGAGTACACAGCCAG
GGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATTAACTACGGGACATTCACCATCAAG
TCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAAATTGTCACCCACGGCCGCATCCCTTACCCAGGGA
TGACCAACCCGGAGGTGATTCAGAACCTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGA
GGAGCTGTACCAACTCATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTG
CGCAGTGTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCT


ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI Cloning Scheme for this gene Plasmid Map
ACCN NM_005356
ORF Size 1527 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005356.5
RefSeq Size 2032 bp
RefSeq ORF 1530 bp
Locus ID 3932
UniProt ID P06239
Cytogenetics 1p35.2
Domains pkinase, SH2, SH3, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase, Stem cell - Pluripotency
Protein Pathways Natural killer cell mediated cytotoxicity, Primary immunodeficiency, T cell receptor signaling pathway
MW 57.8 kDa
Summary This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016]
Write Your Own Review
You're reviewing:LCK (NM_005356) Human Tagged ORF Clone
Your Rating
SKU Description Size Price
RC219375L1 Lenti ORF clone of Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2, Myc-DDK-tagged 10 ug
$1,011.00
RC219375L2 Lenti ORF clone of Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2, mGFP tagged 10 ug
$1,011.00
RC219375L3 Lenti ORF clone of Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2, Myc-DDK-tagged 10 ug
$1,011.00
RC219375L4 Lenti ORF clone of Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2, mGFP tagged 10 ug
$1,011.00
RG219375 LCK (tGFP-tagged) - Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2 10 ug
$911.00
SC116770 LCK (untagged)-Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2 10 ug
$475.00
SC323616 LCK (untagged)-Kinase deficient mutant (K273M) of Human lymphocyte-specific protein tyrosine kinase (LCK), transcript variant 2 10 ug
$475.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.