Ccl21a (NM_011124) Mouse Tagged ORF Clone

SKU MR225945

Ccl21a (Myc-DDK-tagged) - Mouse chemokine (C-C motif) ligand 21A (serine) (Ccl21a)

Product Data

• Type: Mouse Tagged ORF Clone
• Target Symbol: Ccl21a
• Synonyms: 6CKBAC2; 6Ckine; ALP; AW987545; CKb9; plt; Scya21; SCYA21a; Scya21b; SLC; Tca4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >MR225945 representing NM_011124; Red=Cloning site Blue=ORF Green=Tags(s); ; TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC; GCCGCGATCGCC; ; ATGGCTCAGATGATGACTCTGAGCCTCCTTAGCCTGGTCCTGGCTCTCTGCATCCCCTGGACCCAAGGCA; GTGATGGAGGGGGACAGGACTGCTGCCTTAAGTACAGCCAGAAGAAAATTCCCTACAGTATTGTCCGAGG; CTATAGGAAGCAAGAACCAAGTTTAGGCTGTCCCATCCCGGCAATCCTGTTCTTACCCCGGAAGCACTCT; AAGCCTGAGCTATGTGCAAACCCTGAGGAAGGCTGGGTGCAGAACCTGATGCGCCGCCTGGACCAGCCTC; CAGCCCCAGGGAAACAAAGCCCCGGCTGCAGGAAGAACCGGGGAACCTCTAAGTCTGGAAAGAAAGGAAA; GGGCTCCAAGGGCTGCAAGAGAACTGAACAGACACAGCCCTCAAGAGGA; ; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT; ACAAGGATGACGACGATAAGGTTTAA
• Chromatograms: Chromatograms ; Sequencher program is needed, download here
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene Plasmid Map
• ACCN: NM_011124
• ORF Size: 399 bp
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_011124.1, NM_011124.2, NM_011124.3, NM_011124.4, NP_035254.1
• RefSeq Size: 868 bp
• RefSeq ORF: 402 bp
• Locus ID: 18829
• UniProt ID: P84444
• Cytogenetics: 4 22.81 cM
• MW: 15 kDa
• Summary: Inhibits hemopoiesis and stimulates chemotaxis. Chemotactic in vitro for thymocytes and activated T-cells, but not for B-cells, macrophages, or neutrophils. Potent mesangial cell chemoattractant. Shows preferential activity towards naive T-cells. May play a role in mediating homing of lymphocytes to secondary lymphoid organs.[UniProtKB/Swiss-Prot Function]