Tsen15 (NM_025677) Mouse Tagged ORF Clone

CAT#: MR215931

Tsen15 (Myc-DDK-tagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15)

Product Images

Circular map for MR215931

Specifications

Product Data

• Type: Mouse Tagged ORF Clone
• Tag: Myc-DDK
• Symbol: Tsen15
• Synonyms: 5730449L18Rik; AL023077; Sen15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  ORF Nucleotide Sequence

  >MR215931 representing NM_025677
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAGGAGCGCAGCGATTCCGAACCTACCCCGGGATGTAGCGGGCCTGGCCCGGCTCCCGTTCGCGATG
  GCGGCGGCGCCCACACATGGGCTCCGGAGGACGCCTGGATGGGCACACACCCTAAGTACTTAGAAATGAT
  GGAATTAGATATAGGAGATGCCACCCAAGTTTATATAGCATTCTTGGTTTACCTGGATCTCATGGAGAGT
  AAAAGTTGGCATGAAGTAAACTGTGTAGGAATACCAGAACTACAACTCATCTGCCTCCTTGGCACTGAGA
  TCGAAGGGGAAGGGCTGCAGACGGTGGTGCCTACACCCATTTCTGCTTCCCTCAGCCATAATAGGATAAG
  GGAAATCTTGAAGGCGTCTAGAAAGTTGCAAGGCGATCCAGAACTGCCGATGTCTTTTACTTTGGCCATA
  GTGGAGTCAGATTCCACAATAGTCTATTATAAACTTACCGATGGATTTATGCTGCCAGACCCTCAGAATA
  TTTCTCTTAGAAGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI Cloning Scheme for this gene Plasmid Map
• ACCN: NM_025677
• ORF Size: 504 bp
• OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_025677.1, NM_025677.2, NM_025677.3, NP_079953.2
• RefSeq Size: 1147 bp
• RefSeq ORF: 507 bp
• Locus ID: 66637
• UniProt ID: Q8R3W5
• Cytogenetics: 1 G2
• MW: 19 kDa
• Gene Summary: Non-catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5' and 3' splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3' cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre-mRNA 3'-end processing factors, establishing a link between pre-tRNA splicing and pre-mRNA 3'-end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events (By similarity).[UniProtKB/Swiss-Prot Function]