Tsen15 (NM_025677) Mouse Untagged Clone

CAT#: MC210410

Tsen15 (untagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tsen15 (NM_025677) Mouse Untagged Clone
Symbol Tsen15
Synonyms 5730449L18Rik; AL023077; Sen15
Vector pCMV6-Entry
Sequence Data
>MC210410 representing NM_025677
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAGCGCAGCGATTCCAAACCTACCCCGGGATGTAGCGGGCCTGGCCCGGCTCCCGTTCGCGATG
GCGGCGGCGCCCACACATGGGCTCCGGAGGACGCCTGGATGGGCACACACCCTAAGTATTTAGAAATGAT
GGAATTAGATATAGGAGATGCCACCCAAGTTTATATAGCATTCTTGGTTTACCTGGATCTCATGGAGAGT
AAAAGTTGGCATGAAGTAAACTGTGTAGGAATACCAGAACTACAACTCATCTGCCTCCTTGGCACTGAGA
TCGAAGGGGAAGGGCTGCAGACGGTGGTGCCTACACCCATTTCTGCTTCCCTCAGCCATAATAGGATAAG
GGAAATCTTGAAGGCGTCTAGAAAGTTGCAAGGCGATCCAGAACTGCCGATGTCTTTTACTTTGGCCATA
GTGGAGTCAGATTCCACAATAGTCTATTATAAACTTACCGATGGATTTATGCTGCCAGACCCTCAGAATA
TTTCTCTTAGAAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_025677
ORF Size 507 bp
Insert Size 507
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_025677.3, NP_079953
RefSeq Size 1147
RefSeq ORF 507
Locus ID 66637
Cytogenetics 1|1 G2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.