Tsen15 (NM_025677) Mouse Untagged Clone
CAT#: MC210410
Tsen15 (untagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15), (10ug)
"NM_025677" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Tsen15 |
Synonyms | 5730449L18Rik; AL023077; Sen15 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210410 representing NM_025677
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGAGCGCAGCGATTCCAAACCTACCCCGGGATGTAGCGGGCCTGGCCCGGCTCCCGTTCGCGATG GCGGCGGCGCCCACACATGGGCTCCGGAGGACGCCTGGATGGGCACACACCCTAAGTATTTAGAAATGAT GGAATTAGATATAGGAGATGCCACCCAAGTTTATATAGCATTCTTGGTTTACCTGGATCTCATGGAGAGT AAAAGTTGGCATGAAGTAAACTGTGTAGGAATACCAGAACTACAACTCATCTGCCTCCTTGGCACTGAGA TCGAAGGGGAAGGGCTGCAGACGGTGGTGCCTACACCCATTTCTGCTTCCCTCAGCCATAATAGGATAAG GGAAATCTTGAAGGCGTCTAGAAAGTTGCAAGGCGATCCAGAACTGCCGATGTCTTTTACTTTGGCCATA GTGGAGTCAGATTCCACAATAGTCTATTATAAACTTACCGATGGATTTATGCTGCCAGACCCTCAGAATA TTTCTCTTAGAAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025677 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_025677.3, NP_079953.2 |
RefSeq Size | 1147 bp |
RefSeq ORF | 507 bp |
Locus ID | 66637 |
UniProt ID | Q8R3W5 |
Cytogenetics | 1 G2 |
Gene Summary | Non-catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5' and 3' splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3' cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre-mRNA 3'-end processing factors, establishing a link between pre-tRNA splicing and pre-mRNA 3'-end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215931 | Tsen15 (tGFP-tagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15), (10ug) |
USD 500.00 |
|
MR215931 | Tsen15 (Myc-DDK-tagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15) |
USD 300.00 |
|
MR215931L3 | Lenti ORF clone of Tsen15 (Myc-DDK-tagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15) |
USD 600.00 |
|
MR215931L4 | Lenti ORF clone of Tsen15 (mGFP-tagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review