Tsen15 (NM_025677) Mouse Untagged Clone

CAT#: MC210410

Tsen15 (untagged) - Mouse tRNA splicing endonuclease 15 homolog (S. cerevisiae) (Tsen15), (10ug)


  "NM_025677" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Tsen15 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Tsen15"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Tsen15
Synonyms 5730449L18Rik; AL023077; Sen15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210410 representing NM_025677
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGAGCGCAGCGATTCCAAACCTACCCCGGGATGTAGCGGGCCTGGCCCGGCTCCCGTTCGCGATG
GCGGCGGCGCCCACACATGGGCTCCGGAGGACGCCTGGATGGGCACACACCCTAAGTATTTAGAAATGAT
GGAATTAGATATAGGAGATGCCACCCAAGTTTATATAGCATTCTTGGTTTACCTGGATCTCATGGAGAGT
AAAAGTTGGCATGAAGTAAACTGTGTAGGAATACCAGAACTACAACTCATCTGCCTCCTTGGCACTGAGA
TCGAAGGGGAAGGGCTGCAGACGGTGGTGCCTACACCCATTTCTGCTTCCCTCAGCCATAATAGGATAAG
GGAAATCTTGAAGGCGTCTAGAAAGTTGCAAGGCGATCCAGAACTGCCGATGTCTTTTACTTTGGCCATA
GTGGAGTCAGATTCCACAATAGTCTATTATAAACTTACCGATGGATTTATGCTGCCAGACCCTCAGAATA
TTTCTCTTAGAAGATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025677
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_025677.3, NP_079953.2
RefSeq Size 1147 bp
RefSeq ORF 507 bp
Locus ID 66637
UniProt ID Q8R3W5
Cytogenetics 1 G2
Gene Summary Non-catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5' and 3' splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3' cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. The tRNA splicing endonuclease is also involved in mRNA processing via its association with pre-mRNA 3'-end processing factors, establishing a link between pre-tRNA splicing and pre-mRNA 3'-end formation, suggesting that the endonuclease subunits function in multiple RNA-processing events (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.