Pqbp1 (NM_001252528) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Pqbp1 |
Synonyms | npw38; PQBP-1; Sfc2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC226660 representing NM_001252528
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCGCTTCCTGTTGCGCTGCAGACCCGCTTGGCGAAGAGGGGCATCCTCAAACATCTGGAGCCGGAGC CAGAGGAAGAGATTATTGCTGAAGACTACGATGATGATCCTGTTGACTATGAGGCCACCCGGATAGAGGG TCTGCCACCGAGCTGGTACAAGGTGTTTGACCCTTCTTGCGGACTCCCTTACTATTGGAATGTGGAGACA GACCTTGTGTCGTGGCTCTCACCACATGATCCTAACTTTGTCGTTACCAAATCCGCCAAGAAAGTCAGGA ACAATAATGCAGATGCTGAGGACAAGTCGGACCGGAATCTTGAAAAGGTGGACAGAAATCATGAGAAGTC AGATCGTAGTCATGAGAAGCCAGACAGGAGCCACGAGAAGGCAGACCGAAACCACGAGAAGAATGACAGA GAACGAGAGCGCAACTACGACAAAGTGGATAGAGAGAGAGATCGGGACAGGGAACGAGAGCGGGCATTTG ACAAGGCAGACCGGGAAGAGGGCAAAGACCGACGCCACCATCGCAGAGAGGAACTGGCTCCTTACCCCAA GAACAAGAAAGCGACGAGCCGCAAAGATGAAGAATTAGACCCCATGGACCCCAGCTCATACTCAGATGCA CCCCGGGGCACATGGTCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGTGCTGACACCACGGCAG CTGGGCCCCTCTTCCAGCAGCGCCCTTACCCTTCCCCGGGCGCTGTGCTCCGCGCCAATGCAGAAGCCTC CCGAACCAAACAGCAGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252528 |
Insert Size | 792 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001252528.1, NP_001239457.1 |
RefSeq Size | 1053 bp |
RefSeq ORF | 792 bp |
Locus ID | 54633 |
UniProt ID | Q91VJ5 |
Cytogenetics | X 3.56 cM |
Summary | Intrinsically disordered protein that acts as a scaffold, and which is involved in different processes, such as pre-mRNA splicing, transcription regulation, innate immunity and neuron development (By similarity). Interacts with splicing-related factors via the intrinsically disordered region and regulates alternative splicing of target pre-mRNA species (PubMed:23512658). May suppress the ability of POU3F2 to transactivate the DRD1 gene in a POU3F2 dependent manner (By similarity). Can activate transcription directly or via association with the transcription machinery (By similarity). May be involved in ATXN1 mutant-induced cell death (By similarity). The interaction with ATXN1 mutant reduces levels of phosphorylated RNA polymerase II large subunit (By similarity). Involved in the assembly of cytoplasmic stress granule, possibly by participating to the transport of neuronal RNA granules (By similarity). Also acts as an innate immune sensor of infection by retroviruses, by detecting the presence of reverse-transcribed DNA in the cytosol (By similarity). Directly binds retroviral reverse-transcribed DNA in the cytosol and interacts with CGAS, leading to activate the cGAS-STING signaling pathway, triggering type-I interferon production (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MR228871 | Pqbp1 (myc-DDK-tagged) - Mouse polyglutamine binding protein 1 (Pqbp1), transcript variant 2 | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.