Pqbp1 (NM_001252528) Mouse Untagged Clone

SKU
MC226660
Pqbp1 (untagged) - Mouse polyglutamine binding protein 1 (Pqbp1), transcript variant 2
  $330.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pqbp1
Synonyms npw38; PQBP-1; Sfc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC226660 representing NM_001252528
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGCTTCCTGTTGCGCTGCAGACCCGCTTGGCGAAGAGGGGCATCCTCAAACATCTGGAGCCGGAGC
CAGAGGAAGAGATTATTGCTGAAGACTACGATGATGATCCTGTTGACTATGAGGCCACCCGGATAGAGGG
TCTGCCACCGAGCTGGTACAAGGTGTTTGACCCTTCTTGCGGACTCCCTTACTATTGGAATGTGGAGACA
GACCTTGTGTCGTGGCTCTCACCACATGATCCTAACTTTGTCGTTACCAAATCCGCCAAGAAAGTCAGGA
ACAATAATGCAGATGCTGAGGACAAGTCGGACCGGAATCTTGAAAAGGTGGACAGAAATCATGAGAAGTC
AGATCGTAGTCATGAGAAGCCAGACAGGAGCCACGAGAAGGCAGACCGAAACCACGAGAAGAATGACAGA
GAACGAGAGCGCAACTACGACAAAGTGGATAGAGAGAGAGATCGGGACAGGGAACGAGAGCGGGCATTTG
ACAAGGCAGACCGGGAAGAGGGCAAAGACCGACGCCACCATCGCAGAGAGGAACTGGCTCCTTACCCCAA
GAACAAGAAAGCGACGAGCCGCAAAGATGAAGAATTAGACCCCATGGACCCCAGCTCATACTCAGATGCA
CCCCGGGGCACATGGTCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGTGCTGACACCACGGCAG
CTGGGCCCCTCTTCCAGCAGCGCCCTTACCCTTCCCCGGGCGCTGTGCTCCGCGCCAATGCAGAAGCCTC
CCGAACCAAACAGCAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001252528
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001252528.1, NP_001239457.1
RefSeq Size 1053 bp
RefSeq ORF 792 bp
Locus ID 54633
UniProt ID Q91VJ5
Cytogenetics X 3.56 cM
Summary Intrinsically disordered protein that acts as a scaffold, and which is involved in different processes, such as pre-mRNA splicing, transcription regulation, innate immunity and neuron development (By similarity). Interacts with splicing-related factors via the intrinsically disordered region and regulates alternative splicing of target pre-mRNA species (PubMed:23512658). May suppress the ability of POU3F2 to transactivate the DRD1 gene in a POU3F2 dependent manner (By similarity). Can activate transcription directly or via association with the transcription machinery (By similarity). May be involved in ATXN1 mutant-induced cell death (By similarity). The interaction with ATXN1 mutant reduces levels of phosphorylated RNA polymerase II large subunit (By similarity). Involved in the assembly of cytoplasmic stress granule, possibly by participating to the transport of neuronal RNA granules (By similarity). Also acts as an innate immune sensor of infection by retroviruses, by detecting the presence of reverse-transcribed DNA in the cytosol (By similarity). Directly binds retroviral reverse-transcribed DNA in the cytosol and interacts with CGAS, leading to activate the cGAS-STING signaling pathway, triggering type-I interferon production (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_001252528" in other vectors (1)
SKU Description Size Price
MR228871 Pqbp1 (myc-DDK-tagged) - Mouse polyglutamine binding protein 1 (Pqbp1), transcript variant 2 10 ug
$289.00 $300.00

Welcome to OriGene AI!

I'm your AI-powered guide to everything OriGene.
Ask me anything:

  • Product specs
  • Ordering help
  • Technical questions
  • How to find exactly what your experiment needs

Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.

Velaro Chat Img

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.