Dmrt2 (BC027669) Mouse Untagged Clone

SKU
MC218000
Dmrt2 (untagged) - Mouse doublesex and mab-3 related transcription factor 2 (cDNA clone MGC:41586 IMAGE:1248080), (10ug)
$330.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dmrt2
Synonyms Terra
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC027669
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGAAGAGAAGAGCCTTTGCTGACAAGGAGTTGGAGAACATTATGCTGGAGAGAGAATATAAAGAGA
GGGAGATGTTAGAAACATCTCAAGCTGCTGCCTTATTCCTGCCCAACCGTATGGTGCCTGGACCCGAGTA
CAGTTCCTACAAAGGTACCTACAGCCCCACTGCAGGAGAGCTGCCGAGCAAGGACTTCTGTAACTTTTTA
CCTACCTGCCTTGATCTCACCATGCAGTATTCAGGGTCTGGGAATATGGAACTTATTTCTTCTAACGTCA
GTGTGGCCACAACTTACAGACAATATCCCCTGTCCTCACGATTTTTAGTTTGGCCCAAGTGCGGTCCCAT
TAGTGACACCCTTCTCTACCAGCAATATCTGTTAAATGCTACCACTTCTGTCCAAGCTCTGAAGCCGGGG
ACCGGCTGGGACTTGAAAGGAACCCGAGTTCAGGATGGGCTTAGCGCAGAGCAAGACATGATGCCACCCA
AACTGGAAGGCTCTCTGGTGCTGCCCCATCTGCCAGAGGTCCCAGCCTCGAGAACAGACCTTCAGGTTCA
CCAGGTGGTTCCAGAGAGGTCTGCCTTCTCCCCACCCGGTCGGAATTTCTCTCCCATTGTTGATATGGAC
TGCCTGGCAGCTCAAGGGCACGTCTTAACCAAGCTCAGCAAAGAAAACACTAGACCTTCTCTGCCACTTA
AAACTAATCCATTCCACTCAGTATTCCAGCAGACGCTCAGCGACAAATCAGGCCCTGAGTTGAACGCACC
ATTTGTCAAAGAAGCCTTTGAAGAGACCCCAAAGAAACACAGAGAGTGTTTGGTCAAGGAGAGCCAGAAG
TACACATTTACAATAGACAGATGCGCAAAAGACCTCTTTGTAGCCAAACAAGTTGGAACGAAACTTTCGG
CGAATGAGCCACTGTCGTTCTCTGTCGAATCTATTCTTAAGAGGCCTTCATCTGCCGTCACTCACGTCTC
TCAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC027669
Insert Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC027669, AAH27669
RefSeq Size 1304 bp
RefSeq ORF 986 bp
Locus ID 226049
Cytogenetics 19 C1
Summary Transcriptional activator that directly regulates early activation of the myogenic determination gene MYF5 by binding in a sequence-specific manner to the early epaxial enhancer element of it. Involved in somitogenesis during embryogenesis and somite development and differentiation into sclerotome and dermomyotome. Required for the initiation and/or maintenance of proper organization of the sclerotome, dermomyotome and myotome. Is not required for sex determination and/or differentiation in embryonic development. Also not involved in symmetric somite formation and hence does not regulate the laterality pathway that controls left-right asymmetric organ positioning.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Dmrt2 (BC027669) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG204805 Dmrt2 (tGFP-tagged) - Mouse doublesex and mab-3 related transcription factor 2 (cDNA clone MGC:41586 IMAGE:1248080) 10 ug
$500.00
MR204805 Dmrt2 (Myc-DDK-tagged) - Mouse doublesex and mab-3 related transcription factor 2 (cDNA clone MGC:41586 IMAGE:1248080) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR204805L3 Lenti ORF clone of Dmrt2 (Myc-DDK-tagged) - Mouse doublesex and mab-3 related transcription factor 2 (cDNA clone MGC:41586 IMAGE:1248080) 10 ug
$600.00
MR204805L4 Lenti ORF clone of Dmrt2 (mGFP-tagged) - Mouse doublesex and mab-3 related transcription factor 2 (cDNA clone MGC:41586 IMAGE:1248080) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.