Eif4e2 (BC049077) Mouse Untagged Clone

SKU
MC217774
Eif4e2 (untagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556), (10ug)
$330.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Eif4e2
Synonyms 2700069E09Rik; AI036339; AV129531; D0H0S6743E; Eif4el3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC049077
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAACAAGTTCGACGCCTTAAAAGATGATGACAGTGGAGACCATGATCAGAATGAAGAAAACAGCA
CACAGAAAGATGGTGAGAAGGAAAAAACAGACCGAGACAAGAGCCAGAGCAGTGGCAAGAGGAAGGCTGT
TGTCCCTGGACCAGCAGAGCATCCCCTGCAGTACAACTACACCTTTTGGTACTCGAGGAGAACCCCTGGC
CGTCCCACCAGCTCGCAGAGCTATGAGCAGAACATCAAGCAGATTGGCACCTTTGCCTCTGTGGAGCAGT
TCTGGAAGTTTTACAGCCACATGGTACGTCCTGGGGACCTGACAGGCCACAGTGACTTTCATCTCTTCAA
AGAAGGGATTAAACCTATGTGGGAGGATGATGCAAATAAAAATGGGGGCAAGTGGATCATTCGACTCCGG
AAGGGCTTAGCTTCCCGCTGCTGGGAGAATCTCATCCTGGCTATGCTCGGGGAGCAATTCATGGTTGGGG
AGGAGATCTGCGGGGCTGTGGTCTCTGTCCGCTTTCAGGAGGACATTATTTCTATATGGAATAAGACTGC
CAGCGACCAAGCAACTACAGCCCGAATCCGGGATACTCTTCGGCGCGTGCTTAACCTACCTCCCAACACC
ATTATGGAATACAAAACTCACACCGACAGCATTGCACCTCAGGGAACCATGAGTTCCAAACTATGTCTCA
TGGTTAACCCCTTAAAGGTCACCAGACCTCATGCTTCTACGTTCCCGCTTGGCTCCGTGCACCAACAGAT
CTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC049077
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC049077, AAH49077
RefSeq Size 2855 bp
RefSeq ORF 773 bp
Locus ID 26987
Cytogenetics 1 C5
Summary Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:15153109). Acts as a repressor of translation initiation (By similarity). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (PubMed:15153109).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Eif4e2 (BC049077) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203331 Eif4e2 (tGFP-tagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556) 10 ug
$650.00
MR203331 Eif4e2 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556) 10 ug
$450.00
MR203331L1 Lenti ORF clone of Eif4e2 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556) 10 ug
$750.00
MR203331L2 Lenti ORF clone of Eif4e2 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556) 10 ug
$750.00
MR203331L3 Lenti ORF clone of Eif4e2 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556) 10 ug
$750.00
MR203331L4 Lenti ORF clone of Eif4e2 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 4E member 2 (cDNA clone MGC:61339 IMAGE:5708556) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.