Hdac2 (NM_008229) Mouse Untagged Clone

SKU
MC216798
Hdac2 (untagged) - Mouse histone deacetylase 2 (Hdac2), (10ug)
$732.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Hdac2
Synonyms D10Wsu179e; mRPD3; YAF1; Yy1bp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216798 representing NM_008229
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTACAGTCAAGGAGGCGGCAAGAAGAAAGTGTGCTACTACTATGATGGTGATATTGGCAATTATT
ATTATGGCCAGGGTCATCCCATGAAGCCTCATAGAATCCGGATGACTCATAACTTGCTGCTAAATTATGG
TTTATACCGAAAAATGGAAATATATAGGCCTCATAAAGCCACTGCTGAAGAAATGACTAAATACCACAGC
GATGAGTATATCAAGTTTCTACGATCAATAAGACCAGATAATATGTCTGAGTACAGTAAGCAGATGCAGA
GATTTAACGTCGGAGAAGATTGTCCGGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCCACGGGTGG
TTCAGTTGCTGGGGCTGTGAAATTAAACCGGCAACAAACTGATATGGCTGTCAATTGGGCTGGAGGACTA
CATCATGCCAAGAAGTCAGAAGCATCAGGGTTCTGCTATGTTAATGATATTGTGCTTGCCATCCTCGAAT
TACTTAAGTATCATCAGAGAGTCTTATATATTGACATAGACATCCACCATGGTGATGGTGTTGAGGAAGC
TTTTTATACAACAGATCGCGTGATGACCGTCTCATTCCATAAATATGGGGAATACTTTCCTGGAACAGGA
GACTTGAGGGATATTGGTGCTGGAAAGGGAAAATACTATGCTGTCAATTTTCCCATGAGAGATGGTATAG
ATGATGAATCATATGGACAAATTTTTAAGCCTATCATCTCAAAAGTGATGGAGATGTACCAGCCTAGCGC
GGTGGTGCTGCAGTGTGGCGCAGACTCCCTGTCTGGGGACAGGCTTGGTTGTTTCAATCTAACTGTCAAA
GGTCATGCTAAATGTGTAGAAGTAGTGAAAACTTTTAACTTGCCATTGCTGATGCTCGGTGGAGGAGGCT
ACACAATCCGGAATGTTGCCCGATGTTGGACATATGAGACTGCAGTTGCCCTTGATTGTGAAATTCCCAA
TGAGTTGCCATATAATGATTACTTTGAGTATTTTGGACCAGACTTCAAACTGCATATTAGTCCTTCAAAC
ATGACAAACCAGAACACTCCAGAATATATGGAAAAGATAAAACAGCGTTTATTTGAAAATCTACGTATGT
TACCACATGCACCTGGTGTTCAAATGCAAGCTATTCCAGAGGATGCTGTTCATGAAGACAGTGGAGATGA
GGATGGAGAAGACCCGGACAAAAGAATTTCCATTCGAGCATCAGACAAACGGATAGCTTGCGATGAAGAG
TTTTCAGATTCTGAGGATGAAGGTGAAGGAGGTCGTAGGAATGTTGCTGATCATAAGAAAGGAGCAAAGA
AGGCTAGGATTGAAGAAGACAAGAAGGAGACAGAGGACAAGAAGACAGATGTTAAGGAAGAAGACAAATC
CAAGGACAATAGTGGTGAGAAAACAGACCCCAAAGGAGCCAAGTCAGAACAACTCAGCAACCCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_008229
Insert Size 1467 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008229.2, NP_032255.2
RefSeq Size 2004 bp
RefSeq ORF 1467 bp
Locus ID 15182
UniProt ID P70288
Cytogenetics 10 B1
Summary Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes (By similarity). Forms transcriptional repressor complexes by associating with MAD, SIN3, YY1 and N-COR. Interacts in the late S-phase of DNA-replication with DNMT1 in the other transcriptional repressor complex composed of DNMT1, DMAP1, PCNA, CAF1. Deacetylates TSHZ3 and regulates its transcriptional repressor activity. Component of a RCOR/GFI/KDM1A/HDAC complex that suppresses, via histone deacetylase (HDAC) recruitment, a number of genes implicated in multilineage blood cell development. May be involved in the transcriptional repression of circadian target genes, such as PER1, mediated by CRY1 through histone deacetylation. Involved in MTA1-mediated transcriptional corepression of TFF1 and CDKN1A.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Hdac2 (NM_008229) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG226709 Hdac2 (tGFP-tagged) - Mouse histone deacetylase 2 (Hdac2), (10ug) 10 ug
$886.00
MR226709 Hdac2 (Myc-DDK-tagged) - Mouse histone deacetylase 2 (Hdac2) 10 ug
$686.00
MR226709L1 Lenti ORF clone of Hdac2 (Myc-DDK-tagged) - Mouse histone deacetylase 2 (Hdac2) 10 ug
$986.00
MR226709L2 Lenti ORF clone of Hdac2 (mGFP-tagged) - Mouse histone deacetylase 2 (Hdac2) 10 ug
$986.00
MR226709L3 Lenti ORF clone of Hdac2 (Myc-DDK-tagged) - Mouse histone deacetylase 2 (Hdac2) 10 ug
$986.00
MR226709L4 Lenti ORF clone of Hdac2 (mGFP-tagged) - Mouse histone deacetylase 2 (Hdac2) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.