Calhm1 (NM_001081271) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Calhm1 |
Synonyms | EG546729 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC215147 representing NM_001081271
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATAAGTTTCGGATGATCTTCCAGTTCTTGCAATCCAACCAAGAGTCCTTCATGAATGGCATCTGTG GCATCATGGCGCTGGCCAGTGCGCAGATGTATTCTGCCTTTGACTTCAACTGCCCCTGCTTACCCGGCTA CAACGTGGTCTACAGCCTGGGCATACTGCTGACGCCTCCCCTGGTGCTCTTCCTGCTTGGTCTGGTCATG AACAACAACATATCCATGCTAGCTGAAGAGTGGAAGCGCCCCGCAGGTCGCCGGGCCAAGGACCCAGCTG TTCTACGCTACATGTTCTGTTCCATGGCCCAGAGAGCTCTCATCGCCCCTGTCGTCTGGGTGGCTGTCAC ACTGCTGGATGGCAAGTGCTTTCTCTGTGCCTTCTGCACAGCTGTGCCCGTGGCCACACTAGGCAATGGC AGCCTGGTGCCGGGCCTGCCTGCTCCAGAACTTGCTCGCCTACTGGCTCGGGTACCCTGCCCTGAGATCT ATGATGGGAACTGGCTGCTAGCCCGAGAGGTGGCCGTGCGGTATTTGCGCTGCATCTCTCAGGCACTGGG TTGGTCCTTCGTGCTGCTGACCACATTACTAGCGTTCGTGGTACGCTCTGTGCGTCCCTGCTTCACGCAG GTCGCCTTTCTCAAGAGCAAGTACTGGTCCCACTACATTGACATTGAGCGCAAGCTCTTCGATGAGACAT GCACAGAGCATGCCAAAGCCTTTGCTAAGGTATGTATCCAGCAGTTCTTTGAAGCCATGAACCATGACCT GGAACTGGGTCATACCCACGGAGTACTGGCCACGGCCACAGCCACAGCCACAGCCACAGAGGCTGTCCAA AGTCCCTCGGACAGGACAGAAGAAGAGAGGGAGAAGTTGCGTGGCATCACTGACCAAGGCACCATGAATA GGCTACTCACAAGCTGGCACAAATGCAAACCACCACTGAGGCTGGGCCAGGAGGCACCACTGATGAGCAA CGGCTGGGCTGGGGGCGAGCCCCGGCCTCCACGCAAGGAAGTGGCCACCTACTTCAGCAAAGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
Chromatograms
![]() Sequencher program is needed, download here |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081271 |
Insert Size | 1047 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001081271.1, NP_001074740.1 |
RefSeq Size | 1047 bp |
RefSeq ORF | 1047 bp |
Locus ID | 546729 |
UniProt ID | D3Z291 |
Cytogenetics | 19 C3 |
Summary | Pore-forming subunit of a voltage-gated ion channel required for sensory perception of sweet, bitter and umami tastes. Specifically present in type II taste bud cells, where it plays a central role in sweet, bitter and umami taste perception by inducing ATP release from the cell, ATP acting as a neurotransmitter to activate afferent neural gustatory pathways. Acts both as a voltage-gated and calcium-activated ion channel: mediates neuronal excitability in response to changes in extracellular Ca(2+) concentration. Has poor ion selectivity and forms a wide pore (around 14 Angstroms) that mediates permeation of Ca(2+), Na(+) and K(+), as well as permeation of monovalent anions. Acts as an activator of the ERK1 and ERK2 cascade. Triggers endoplasmic reticulum stress by reducing the calcium content of the endoplasmic reticulum. May indirectly control amyloid precursor protein (APP) proteolysis and aggregated amyloid-beta (Abeta) peptides levels in a Ca(2+) dependent manner.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG221396 | Calhm1 (tGFP-tagged) - Mouse calcium homeostasis modulator 1 (Calhm1), (10ug) | 10 ug |
$886.00
|
|
MR221396 | Calhm1 (Myc-DDK-tagged) - Mouse calcium homeostasis modulator 1 (Calhm1) | 10 ug |
$686.00
|
|
MR221396L3 | Lenti ORF clone of Calhm1 (Myc-DDK-tagged) - Mouse calcium homeostasis modulator 1 (Calhm1) | 10 ug |
$986.00
|
|
MR221396L4 | Lenti ORF clone of Calhm1 (mGFP-tagged) - Mouse calcium homeostasis modulator 1 (Calhm1) | 10 ug |
$986.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.