Ffar1 (NM_194057) Mouse Untagged Clone

CAT#: MC212962

Ffar1 (untagged) - Mouse free fatty acid receptor 1 (Ffar1), (10ug)


  "NM_194057" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ffar1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ffar1
Synonyms Gpr40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NM_194057.2
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACCTGCCCCCACAGCTCTCCTTCGCTCTCTATGTATCTGCCTTTGCGCTGGGCTTTCCATTGAACT
TGTTAGCCATCCGAGGCGCAGTGTCCCACGCTAAACTGCGACTCACTCCCAGCTTGGTCTACACTCTCCA
TCTGGGCTGCTCTGATCTCCTACTGGCCATCACTCTGCCCCTGAAGGCTGTGGAGGCCCTGGCTTCTGGA
GCCTGGCCCCTGCCGCTCCCCTTCTGCCCAGTCTTTGCCTTGGCCCACTTTGCTCCCCTCTACGCAGGCG
GAGGCTTCCTAGCTGCTCTCAGCGCTGGCCGCTACCTGGGGGCTGCCTTCCCCTTCGGGTACCAAGCCAT
CCGGAGGCCCCGCTATTCCTGGGGTGTGTGTGTGGCTATATGGGCCCTTGTCCTCTGCCACCTGGGGCTG
GCCCTTGGCTTGGAGACTTCCGGAAGCTGGCTGGACAACAGTACCAGTTCCCTGGGCATCAACATACCCG
TGAATGGCTCCCCGGTCTGCCTGGAAGCCTGGGATCCCGACTCTGCCCGCCCTGCCCGTCTCAGTTTCTC
CATTCTGCTCTTCTTTCTGCCCTTGGTCATCACTGCCTTCTGCTATGTGGGCTGCCTCCGGGCCCTGGTG
CGCTCAGGCCTGAGCCACAAACGGAAGCTCAGGGCAGCTTGGGTGGCCGGAGGCGCTCTCCTCACACTCC
TGCTCTGCCTGGGGCCCTATAATGCCTCCAATGTGGCTAGTTTCATAAACCCGGACCTAGGAGGCTCCTG
GAGGAAGTTGGGACTCATCACAGGGGCCTGGAGTGTGGTACTCAACCCACTGGTCACTGGCTACTTGGGA
ACAGGTCCTGGACGGGGAACAATATGTGTGACGAGGACTCAAAGAGGAACAATTCAGAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_194057
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_194057.2, NP_918946.2
RefSeq Size 903 bp
RefSeq ORF 903 bp
Locus ID 233081
UniProt ID Q76JU9
Cytogenetics 7 B1
Gene Summary G-protein coupled receptor for medium and long chain saturated and unsaturated fatty acids that plays an important role in glucose homeostasis. Fatty acid binding increases glucose-stimulated insulin secretion, and may also enhance the secretion of glucagon-like peptide 1 (GLP-1). May also play a role in bone homeostasis; receptor signaling activates pathways that inhibit osteoclast differentiation (PubMed:23335512). Ligand binding leads to a conformation change that triggers signaling via G-proteins that activate phospholipase C, leading to an increase of the intracellular calcium concentration. Seems to act through a G(q) and G(i)-mediated pathway.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.