Elovl6 (NM_130450) Mouse Untagged Clone

SKU
MC212315
Elovl6 (untagged) - Mouse ELOVL family member 6, elongation of long chain fatty acids (yeast) (Elovl6), (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Elovl6
Synonyms C77826; FAE; LCE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC212315 representing NM_130450
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACATGTCAGTGTTGACTTTACAAGAATATGAATTCGAAAAGCAGTTCAACGAGAACGAAGCCATCC
AATGGATGCAGGAAAACTGGAAGAAGTCTTTCCTGTTTTCTGCGCTGTACGCTGCCTTTATCTTTGGTGG
TCGGCATCTGATGAACAAGCGAGCCAAGTTTGAACTTCGGAAGCCGCTCGTGCTCTGGTCGCTGACTCTT
GCCGTCTTCAGTATATTCGGTGCTCTTCGAACTGGTGCTTACATGCTGTACATTCTGATGACCAAAGGCC
TGAAGCAGTCAGTTTGTGACCAGAGTTTTTACAATGGACCTGTCAGCAAATTCTGGGCTTATGCATTTGT
GCTCAGCAAAGCACCCGAACTAGGTGACACGATATTCATCATTCTGAGGAAACAGAAACTGATCTTCCTG
CACTGGTACCACCACATCACTGTGCTCCTGTACTCCTGGTACTCCTACAAAGACATGGTCGCTGGGGGTG
GTTGGTTCATGACTATGAACTATGGCGTGCATGCCGTCATGTACTCTTACTACGCCTTGCGGGCTGCGGG
TTTCCGAGTCTCCCGGAAGTTTGCCATGTTCATCACCTTGTCCCAGATCACTCAGATGCTGATGGGCTGT
GTCATTAACTACCTGGTCTTCAACTGGATGCAGCATGACAACGACCAGTGCTACTCCCACTTTCAGAACA
TCTTCTGGTCCTCGCTCATGTACCTCAGCTACCTTGTGCTCTTCTGCCATTTCTTCTTTGAGGCCTACAT
CGGCAAAGTGAAGAAAGCCACGAAGGCTGAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_130450
Insert Size 804 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_130450.2, NP_569717.1
RefSeq Size 5951 bp
RefSeq ORF 804 bp
Locus ID 170439
UniProt ID Q920L5
Cytogenetics 3 G3
Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that elongates fatty acids with 12, 14 and 16 carbons with higher activity toward C16:0 acyl-CoAs. Catalyzes the synthesis of unsaturated C16 long chain fatty acids and, to a lesser extent, C18:0 and those with low desaturation degree. May participate in the production of saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Elovl6 (NM_130450) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203544 Elovl6 (tGFP-tagged) - Mouse ELOVL family member 6, elongation of long chain fatty acids (yeast) (Elovl6) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
MR203544 Elovl6 (Myc-DDK-tagged) - Mouse ELOVL family member 6, elongation of long chain fatty acids (yeast) (Elovl6) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR203544L3 Lenti ORF clone of Elovl6 (Myc-DDK-tagged) - Mouse ELOVL family member 6, elongation of long chain fatty acids (yeast) (Elovl6) 10 ug
$600.00
MR203544L4 Lenti ORF clone of Elovl6 (mGFP-tagged) - Mouse ELOVL family member 6, elongation of long chain fatty acids (yeast) (Elovl6) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.