Spaca3 (NM_029367) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Spaca3 |
Synonyms | 1700025M08Rik; ALLP17; Lyc3; mSLLP1; SLLP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC211671 representing NM_029367
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTGGCCCTGGCCT ATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGCTGTGAGCTGGCCAAAGAGAT GCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTGGCTGACTGGGTCTGCCTTGCTTACTACACA AGTGGCTTCAACACAAATGCTGTGGATCATGAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCA GCAGCCGGAGGTGGTGCAGAACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTT GTTGAACAATGATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCTCAGTGACTGGGTGGATGGCTGTGACTTCT AG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_029367 |
Insert Size | 492 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_029367.1, NP_083643.1 |
RefSeq Size | 941 bp |
RefSeq ORF | 492 bp |
Locus ID | 75622 |
UniProt ID | Q9D9X8 |
Cytogenetics | 11 B5 |
Summary | Sperm surface membrane protein that may be involved in sperm-egg plasma membrane adhesion and fusion during fertilization. It could be a potential receptor for the egg oligosaccharide residue N-acetylglucosamine, which is present in the extracellular matrix over the egg plasma membrane. The processed form has no detectable bacteriolytic activity in vitro (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG219897 | Spaca3 (tGFP-tagged) - Mouse sperm acrosome associated 3 (Spaca3), (10ug) | 10 ug |
$350.00
|
|
MR219897 | Spaca3 (Myc-DDK-tagged) - Mouse sperm acrosome associated 3 (Spaca3) | 10 ug |
$289.00
|
|
MR219897L3 | Lenti ORF clone of Spaca3 (Myc-DDK-tagged) - Mouse sperm acrosome associated 3 (Spaca3) | 10 ug |
$450.00
|
|
MR219897L4 | Lenti ORF clone of Spaca3 (mGFP-tagged) - Mouse sperm acrosome associated 3 (Spaca3) | 10 ug |
$450.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.