Cxcl11 (NM_019494) Mouse Untagged Clone

SKU
MC210014
Cxcl11 (untagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1, (10ug)
$150.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cxcl11
Synonyms b-R1; betaR1; Cxc11; H174; I-tac; Ip9; Itac; Scyb9b; Scyb11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210014 representing NM_019494
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAGGAAGGTCACAGCCATAGCCCTGGCTGCGATCATCTGGGCCACAGCTGCTCAAGGCTTCCTTA
TGTTCAAACAGGGGCGCTGTCTTTGCATCGGCCCCGGGATGAAAGCCGTCAAAATGGCAGAGATCGAGAA
AGCTTCTGTAATTTACCCGAGTAACAGCTGCGACAAAGTTGAAGTGATTGTTACTATGAAGGCTCATAAA
CGACAAAGGTGCCTGGACCCCAGATCCAAGCAAGCTCGCCTCATAATGCAGGCAATAGAAAAAAAGAATT
TTTTAAGGCGTCAAAACATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_019494
Insert Size 303 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC025903, AAH25903
RefSeq Size 969 bp
RefSeq ORF 303 bp
Locus ID 56066
UniProt ID Q9JHH5
Cytogenetics 5 E2
Summary Chemotactic for interleukin-activated T-cells but not unstimulated T-cells, neutrophils or monocytes. Induces calcium release in activated T-cells. Binds to CXCR3. May play an important role in CNS diseases which involve T-cell recruitment. May play a role in skin immune responses (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1, coding) represents the shorter transcript but encodes the functional protein. This variant, which is based on a transcript from the BALB/c mouse strain, includes a 1-nt insertion in the 5'-most exon compared to the reference genome sequence, which represents a null mutant allele (C57BL/6 strain).
Write Your Own Review
You're reviewing:Cxcl11 (NM_019494) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG222244 Cxcl11 (tGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), (10ug) 10 ug
$350.00
MR222244 Cxcl11 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 10 ug
$289.00
MR222244L3 Lenti ORF clone of Cxcl11 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 10 ug
$450.00
MR222244L4 Lenti ORF clone of Cxcl11 (mGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 11 (Cxcl11), transcript variant 1 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.