Nr1i2 (NM_010936) Mouse Untagged Clone

CAT#: MC209057

Nr1i2 (untagged) - Mouse nuclear receptor subfamily 1, group I, member 2 (Nr1i2), transcript variant 1, (10ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nr1i2 (NM_010936) Mouse Untagged Clone
Symbol Nr1i2
Synonyms mPXR; PXR; PXR.1; PXR.2; PXR1; SXR
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC209057 representing NM_010936
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGACCTGAGGAGAGCTGGAGCCGAGTTGGCCTTGTACAGTGTGAAGAAGCAGACTCTGCCTTGGAAG
AGCCCATCAACGTAGAGGAGGAAGATGGAGGTCTTCAAATCTGCCGTGTATGTGGGGACAAGGCCAATGG
CTACCACTTCAATGTCATGACGTGTGAAGGATGCAAGGGGTTTTTCAGAAGGGCCATGAAACGCAATGTC
CGGCTGAGGTGCCCCTTCCGCAAGGGAACCTGCGAGATCACCCGGAAGACACGACGGCAGTGCCAGGCCT
GCCGTTTGCGCAAGTGCCTGGAGAGTGGCATGAAGAAAGAGATGATCATGTCCGATGCCGCTGTGGAGCA
GAGGCGGGCCTTGATCAAGAGGAAGAAGAGGGAAAAGATTGAGGCTCCACCGCCTGGAGGGCAGGGGCTG
ACGGAAGAACAGCAGGCGCTGATCCAGGAGCTGATGGACGCTCAGATGCAAACCTTTGACACAACTTTCT
CCCACTTCAAGGATTTCCGGCTGCCTGCAGTGTTCCACAGTGGCTGTGAGCTTCCAGAGTTTCTGCAGGC
CTCACTGTTGGAAGACCCTGCCACATGGAGTCAAATCATGAAAGACAGGGTTCCAATGAAGATCTCTCTG
CAGCTGCGCGGAGAAGACGGCAGCATCTGGAACTACCAACCCCCTTCCAAGAGCGACGGGAAAGAGATCA
TCCCTCTTCTGCCACACCTGGCCGATGTGTCAACCTACATGTTCAAGGGCGTCATCAACTTCGCCAAAGT
CATATCCTACTTTAGGGACCTGCCTATTGAGGACCAGATCTCCCTGCTGAAGGGGGCCACTTTTGAGATG
TGCATCCTGAGGTTCAACACGATGTTCGACACGGAAACGGGAACCTGGGAGTGCGGCCGGCTGGCTTACT
GCTTCGAAGACCCTAATGGTGGCTTCCAGAAACTTCTGTTGGATCCATTGATGAAATTCCACTGCATGCT
GAAGAAGCTACAGCTGCATAAGGAGGAGTATGTGCTGATGCAGGCCATCTCCCTCTTCTCCCCAGATCGT
CCTGGTGTGGTCCAGCGCAGCGTGGTAGACCAACTGCAGGAGAGGTTTGCCCTCACCCTGAAGGCCTACA
TTGAGTGTAGTCGGCCATATCCTGCTCACAGGTTCCTGTTCCTGAAGATCATGGCCGTCCTCACTGAGCT
GCGAAGCATCAACGCCCAGCAAACCCAGCAGTTGCTGCGCATCCAAGACTCGCACCCCTTTGCCACCCCA
CTCATGCAAGAGTTATTTAGCAGCACAGATGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_010936
ORF Size 1296 bp
Insert Size 1296
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC120796, NP_035066
RefSeq Size 1565
RefSeq ORF 1296
Locus ID 18171
Cytogenetics 16|16 B3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)