Pnoc (NM_010932) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Pnoc |
Synonyms | N/O; N/OFQ; N23; Np; Npnc1; OFQ; OFQ/N; p |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC209049 representing NM_010932
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAAATCCTCTTTTGTGACGTTCTGCTGCTCAGCCTGCTCTCCAGCGTGTTCAGCAGCTGTCCCAGGG ACTGCCTCACCTGCCAGGAGAAGCTCCACCCAGCTCCAGACAGCTTCAACTTAAAGACGTGCATCCTCCA GTGTGAAGAGAAGGTCTTCCCCCGCCCTCTCTGGACTGTATGCACCAAAGTCATGGCCAGTGGCTCCGGG CAGCTCAGCCCTGCTGACCCAGAGCTTGTGTCAGCTGCTCTTTACCAGCCAAAGGCCTCGGAGATGCAGC ACCTGAAGAGAATGCCGCGTGTCCGGAGCTTGGTGCAAGTGCGAGATGCAGAGCCTGGCGCAGATGCTGA GCCTGGCGCAGATGCTGAGCCTGGCGCAGATGACGCTGAGGAGGTGGAGCAGAAGCAGCTGCAGAAAAGG TTTGGGGGCTTCACCGGGGCCCGGAAATCAGCCCGGAAGTTGGCCAACCAGAAGCGGTTCAGTGAGTTTA TGAGGCAGTACCTGGTCCTGAGCATGCAGTCAAGTCAACGCCGGCGCACCCTGCACCAGAATGGTAATGT GTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010932 |
Insert Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_010932.2, NP_035062.1 |
RefSeq Size | 2157 bp |
RefSeq ORF | 564 bp |
Locus ID | 18155 |
UniProt ID | Q64387 |
Cytogenetics | 14 D1 |
Summary | This gene encodes the precursor for neuropeptides that have been implicated in a wide range of physiological roles such as transmission and sensitivity to pain, learning, memory, anxiety and depression, in the central nervous system. The encoded protein is a precursor that is proteolytically processed to generate multiple biologically active peptides including nociceptin and nocistatin which have opposite functions in pain transmission. Mice lacking the encoded protein display increased anxiety, elevated basal pain threshold and impaired adaptation to repeated stress. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter protein (isoform 1, also known as N23K). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG220607 | Pnoc (tGFP-tagged) - Mouse prepronociceptin (Pnoc), (10ug) | 10 ug |
$500.00
|
|
MR220607 | Pnoc (Myc-DDK-tagged) - Mouse prepronociceptin (Pnoc), transcript variant 1 | 10 ug |
$289.00
MSRP
$300.00
MSRP
$300.00
|
|
MR220607L3 | Lenti ORF clone of Pnoc (Myc-DDK-tagged) - Mouse prepronociceptin (Pnoc), transcript variant 1 | 10 ug |
$600.00
|
|
MR220607L4 | Lenti ORF clone of Pnoc (mGFP-tagged) - Mouse prepronociceptin (Pnoc), transcript variant 1 | 10 ug |
$600.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.