Pnoc (NM_010932) Mouse Untagged Clone

SKU
MC209049
Pnoc (untagged) - Mouse prepronociceptin (Pnoc), transcript variant 1, (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Pnoc
Synonyms N/O; N/OFQ; N23; Np; Npnc1; OFQ; OFQ/N; p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209049 representing NM_010932
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAAATCCTCTTTTGTGACGTTCTGCTGCTCAGCCTGCTCTCCAGCGTGTTCAGCAGCTGTCCCAGGG
ACTGCCTCACCTGCCAGGAGAAGCTCCACCCAGCTCCAGACAGCTTCAACTTAAAGACGTGCATCCTCCA
GTGTGAAGAGAAGGTCTTCCCCCGCCCTCTCTGGACTGTATGCACCAAAGTCATGGCCAGTGGCTCCGGG
CAGCTCAGCCCTGCTGACCCAGAGCTTGTGTCAGCTGCTCTTTACCAGCCAAAGGCCTCGGAGATGCAGC
ACCTGAAGAGAATGCCGCGTGTCCGGAGCTTGGTGCAAGTGCGAGATGCAGAGCCTGGCGCAGATGCTGA
GCCTGGCGCAGATGCTGAGCCTGGCGCAGATGACGCTGAGGAGGTGGAGCAGAAGCAGCTGCAGAAAAGG
TTTGGGGGCTTCACCGGGGCCCGGAAATCAGCCCGGAAGTTGGCCAACCAGAAGCGGTTCAGTGAGTTTA
TGAGGCAGTACCTGGTCCTGAGCATGCAGTCAAGTCAACGCCGGCGCACCCTGCACCAGAATGGTAATGT
GTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_010932
Insert Size 564 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_010932.2, NP_035062.1
RefSeq Size 2157 bp
RefSeq ORF 564 bp
Locus ID 18155
UniProt ID Q64387
Cytogenetics 14 D1
Summary This gene encodes the precursor for neuropeptides that have been implicated in a wide range of physiological roles such as transmission and sensitivity to pain, learning, memory, anxiety and depression, in the central nervous system. The encoded protein is a precursor that is proteolytically processed to generate multiple biologically active peptides including nociceptin and nocistatin which have opposite functions in pain transmission. Mice lacking the encoded protein display increased anxiety, elevated basal pain threshold and impaired adaptation to repeated stress. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter protein (isoform 1, also known as N23K).
Write Your Own Review
You're reviewing:Pnoc (NM_010932) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG220607 Pnoc (tGFP-tagged) - Mouse prepronociceptin (Pnoc), (10ug) 10 ug
$500.00
MR220607 Pnoc (Myc-DDK-tagged) - Mouse prepronociceptin (Pnoc), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR220607L3 Lenti ORF clone of Pnoc (Myc-DDK-tagged) - Mouse prepronociceptin (Pnoc), transcript variant 1 10 ug
$600.00
MR220607L4 Lenti ORF clone of Pnoc (mGFP-tagged) - Mouse prepronociceptin (Pnoc), transcript variant 1 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.