Jun (NM_010591) Mouse Untagged Clone

SKU
MC208799
Jun (untagged) - Mouse Jun oncogene (Jun), (10ug)
$457.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Jun
Synonyms AP-1; c-jun; Junc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_010591, the custom clone sequence may differ by one or more nucleotides


ATGACTGCAAAGATGGAAACGACCTTCTACGACGATGCCCTCAACGCCTCGTTCCTCCAGTCCGAGAGCG
GTGCCTACGGCTACAGTAACCCTAAGATCCTAAAACAGAGCATGACCTTGAACCTGGCCGACCCGGTGGG
CAGTCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTTCTCACGTCGCCCGACGTCGGGCTGCTCAAG
CTGGCGTCGCCGGAGCTGGAGCGCCTGATCATCCAGTCCAGCAATGGGCACATCACCACTACACCGACCC
CCACCCAGTTCTTGTGCCCCAAGAACGTGACCGACGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGC
CCTGGCTGAACTGCATAGCCAGAACACGCTTCCCAG:TGTCACCTCCGCGGCACAGCCGGTCAGCGGGGC
GGGCATGGTGGCTCCCGCGGTGGCCTCAGTAGCAGGCGCTGGCGGCGGTGGTGGCTACAGCGCCAGCCTG
CACAGTGAGCCTCCGGTCTACGCCAACCTCAGCAACTTCAACCCGGGTGCGCTGAGCAGCGGCGGTGGGG
CGCCCTCCTATGGCGCGGCCGGGCTGGCCTTTCCCTCGCAGCCGCAGCAGCAGCAGCAGCCGCCTCAGCC
GCCGCACCACTTGCCCCAACAGATCCCGGTGCAGCACCCGCGGCTGCAAGCCCTGAAGGAAGAGCCGCAG
ACCGTGCCGGAGATGCCGGGAGAGACGCCGCCCCTGTCCCCTATCGACATGGAGTCTCAGGAGCGGATCA
AGGCAGAGAGGAAGCGCATGAGGAACCGCATTGCCGCCTCCAAGTGCCGGAAAAGGAAGCTGGAGCGGAT
CGCTCGGCTAGAGGAAAAAGTGAAAACCTTGAAAGCGCAAAACTCCGAGCTGGCATCCACGGCCAACATG
CTCAGGGAACAGGTGGCACAGCTTAAGCAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGC
TAACGCAGCAGTTGCAAACGTTTTGA


Restriction Sites SgfI-MluI
ACCN NM_010591
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC021888, AAH21888
RefSeq Size 1983 bp
RefSeq ORF 1005 bp
Locus ID 16476
UniProt ID P05627
Cytogenetics 4 43.34 cM
Summary Transcription factor that recognizes and binds to the enhancer heptamer motif 5'-TGA[CG]TCA-3' (PubMed:14707112). Promotes activity of NR5A1 when phosphorylated by HIPK3 leading to increased steroidogenic gene expression upon cAMP signaling pathway stimulation (PubMed:17210646). Involved in activated KRAS-mediated transcriptional activation of USP28 (By similarity). Binds to the USP28 promoter (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Jun (NM_010591) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227043 Jun (tGFP-tagged) - Mouse Jun oncogene (Jun), (10ug) 10 ug
$489.00 MSRP $657.00 MSRP $657.00
MR227043 Jun (Myc-DDK-tagged) - Mouse Jun oncogene (Jun) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
MR227043L1 Lenti ORF clone of Jun (Myc-DDK-tagged) - Mouse Jun oncogene (Jun) 10 ug
$757.00
MR227043L2 Lenti ORF clone of Jun (mGFP-tagged) - Mouse Jun oncogene (Jun) 10 ug
$757.00
MR227043L3 Lenti ORF clone of Jun (Myc-DDK-tagged) - Mouse Jun oncogene (Jun) 10 ug
$757.00
MR227043L4 Lenti ORF clone of Jun (mGFP-tagged) - Mouse Jun oncogene (Jun) 10 ug
$757.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.