Il6 (NM_031168) Mouse Untagged Clone

SKU
MC208786
Il6 (untagged) - Mouse interleukin 6 (Il6), (10ug)
$450.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il6
Synonyms Il; Il-6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208786 representing NM_031168
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGTTCCTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGG
CCTTCCCTACTTCACAAGTCCGGAGAGGAGACTTCACAGAGGATACCACTCCCAACAGACCTGTCTATAC
CACTTCACAAGTCGGAGGCTTAATTACACATGTTCTCTGGGAAATCGTGGAAATGAGAAAAGAGTTGTGC
AATGGCAATTCTGATTGTATGAACAACGATGATGCACTTGCAGAAAACAATCTGAAACTTCCAGAGATAC
AAAGAAATGATGGATGCTACCAAACTGGATATAATCAGGAAATTTGCCTATTGAAAATTTCCTCTGGTCT
TCTGGAGTACCATAGCTACCTGGAGTACATGAAGAACAACTTAAAAGATAACAAGAAAGACAAAGCCAGA
GTCCTTCAGAGAGATACAGAAACTCTAATTCATATCTTCAACCAAGAGGTAAAAGATTTACATAAAATAG
TCCTTCCTACCCCAATTTCCAATGCTCTCCTAACAGATAAGCTGGAGTCACAGAAGGAGTGGCTAAGGAC
CAAGACCATCCAATTCATCTTGAAATCACTTGAAGAATTTCTAAAAGTCACTTTGAGATCTACTCGGCAA
ACCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_031168
Insert Size 636 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC132458, AAI32459
RefSeq Size 709 bp
RefSeq ORF 636 bp
Locus ID 16193
UniProt ID P08505
Cytogenetics 5 15.7 cM
Summary This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Il6 (NM_031168) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG227281 Il6 (tGFP-tagged) - Mouse interleukin 6 (Il6), (10ug) 10 ug
$650.00
MR227281 Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6) 10 ug
$450.00
MR227281L1 Lenti ORF clone of Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6) 10 ug
$750.00
MR227281L2 Lenti ORF clone of Il6 (mGFP-tagged) - Mouse interleukin 6 (Il6) 10 ug
$750.00
MR227281L3 Lenti ORF clone of Il6 (Myc-DDK-tagged) - Mouse interleukin 6 (Il6) 10 ug
$750.00
MR227281L4 Lenti ORF clone of Il6 (mGFP-tagged) - Mouse interleukin 6 (Il6) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.