Fxn (NM_008044) Mouse Untagged Clone

SKU
MC208509
Fxn (untagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein, (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fxn
Synonyms FA; FARR; Frda; X25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208509 representing NM_008044
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGGCGTTCGGAGGTCGCGCAGCCGTGGGCTTGCTGCCCCGGACGGCGTCCCGGGCCTCCGCCTGGG
TCGGGAACCCGCGCTGGAGGGAACCGATCGTAACCTGCGGCCGCCGAGGCCTACATGTCACAGTCAACGC
CGGCGCCACCCGCCACGCCCATTTGAACCTCCACTACCTCCAGATTCTGAACATCAAAAAGCAGAGCGTC
TGCGTGGTGCATTTGAGGAACTTGGGGACATTGGACAACCCAAGCTCTCTAGACGAGACAGCGTATGAAA
GACTGGCGGAAGAGACCCTGGACTCCCTGGCCGAGTTCTTTGAAGACCTCGCAGACAAGCCCTATACCCT
GGAGGACTACGATGTCTCTTTTGGGGATGGCGTGCTCACCATTAAGCTGGGCGGGGATCTAGGGACCTAC
GTGATCAACAAGCAGACCCCAAACAAGCAAATCTGGCTGTCTTCTCCTTCCAGCGGCCCCAAGCGCTATG
ACTGGACCGGGAAGAACTGGGTGTACTCTCATGACGGCGTGTCTCTGCATGAGCTGCTGGCCAGGGAGCT
GACTAAAGCTTTAAACACCAAACTGGACTTGTCTTCATTGGCCTATTCTGGAAAAGGCACTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI
ACCN NM_008044
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_008044.2, NP_032070.1
RefSeq Size 1095 bp
RefSeq ORF 624 bp
Locus ID 14297
UniProt ID O35943
Cytogenetics 19 B
Summary Promotes the biosynthesis of heme and assembly and repair of iron-sulfur clusters by delivering Fe(2+) to proteins involved in these pathways. May play a role in the protection against iron-catalyzed oxidative stress through its ability to catalyze the oxidation of Fe(2+) to Fe(3+); the oligomeric form but not the monomeric form has in vitro ferroxidase activity. May be able to store large amounts of iron in the form of a ferrihydrite mineral by oligomerization. Modulates the RNA-binding activity of ACO1 (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Fxn (NM_008044) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG224586 Fxn (tGFP-tagged) - Mouse frataxin (Fxn) nuclear gene encoding mitochondrial protein, (10ug) 10 ug
$500.00
MR224586 Fxn (Myc-DDK-tagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR224586L3 Lenti ORF clone of Fxn (Myc-DDK-tagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein 10 ug
$600.00
MR224586L4 Lenti ORF clone of Fxn (mGFP-tagged) - Mouse frataxin (Fxn), nuclear gene encoding mitochondrial protein 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.