Fgf2 (NM_008006) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Fgf2 |
Synonyms | bFGF; Fgf-2; Fgfb |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC208486 representing NM_008006
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGCCAGCGGCATCACCTCGCTTCCCGCACTGCCGGAGGACGGCGGCGCCGCCTTCCCACCAGGCC ACTTCAAGGACCCCAAGCGGCTCTACTGCAAGAACGGCGGCTTCTTCCTGCGCATCCATCCCGACGGCCG CGTGGATGGCGTCCGCGAGAAGAGCGACCCACACGTCAAACTACAACTCCAAGCAGAAGAGAGAGGAGTT GTGTCTATCAAGGGAGTGTGTGCCAACCGGTACCTTGCTATGAAGGAAGATGGACGGCTGCTGGCTTCTA AGTGTGTTACAGAAGAGTGTTTCTTCTTTGAACGACTGGAATCTAATAACTACAATACTTACCGGTCACG GAAATACTCCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTCGGATCCAAAACGGGACCT GGACAGAAGGCCATACTGTTTCTTCCAATGTCTGCTAAGAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
Chromatograms
![]() Sequencher program is needed, download here |
Restriction Sites | SgfI-MluI |
ACCN | NM_008006 |
Insert Size | 465 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_008006.2, NP_032032.1 |
RefSeq Size | 695 bp |
RefSeq ORF | 465 bp |
Locus ID | 14173 |
UniProt ID | P15655 |
Cytogenetics | 3 18.41 cM |
Summary | Acts as a ligand for FGFR1, FGFR2, FGFR3 and FGFR4. Also acts as an integrin ligand which is required for FGF2 signaling. Binds to integrin ITGAV:ITGB3. Plays an important role in the regulation of cell survival, cell division, cell differentiation and cell migration. Functions as a potent mitogen in vitro. Can induce angiogenesis.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG227549 | Fgf2 (tGFP-tagged) - Mouse fibroblast growth factor 2 (Fgf2), (10ug) | 10 ug |
$425.00
|
|
MR227549 | Fgf2 (Myc-DDK-tagged) - Mouse fibroblast growth factor 2 (Fgf2) | 10 ug |
$289.00
|
|
MR227549L3 | Lenti ORF clone of Fgf2 (Myc-DDK-tagged) - Mouse fibroblast growth factor 2 (Fgf2) | 10 ug |
$525.00
|
|
MR227549L4 | Lenti ORF clone of Fgf2 (mGFP-tagged) - Mouse fibroblast growth factor 2 (Fgf2) | 10 ug |
$525.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.