Actb (NM_007393) Mouse Untagged Clone

SKU
MC208102
Actb (untagged) - Mouse actin, beta (Actb), (10ug)
$686.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Actb
Synonyms Act; Actx; beta-a; beta-actin; E430023M04Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208102 representing NM_007393
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGACGATATCGCTGCGCTGGTCGTCGACAACGGCTCCGGCATGTGCAAAGCCGGCTTCGCGGGCG
ACGATGCTCCCCGGGCTGTATTCCCCTCCATCGTGGGCCGCCCTAGGCACCAGGGTGTGATGGTGGGAAT
GGGTCAGAAGGACTCCTATGTGGGTGACGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCC
ATTGAACATGGCATTGTTACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGC
TGCGTGTGGCCCCTGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCCCTGAACCCTAAGGCCAACCGTGA
AAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTAGCCATCCAGGCTGTGCTG
TCCCTGTATGCCTCTGGTCGTACCACAGGCATTGTGATGGACTCCGGAGACGGGGTCACCCACACTGTGC
CCATCTACGAGGGCTATGCTCTCCCTCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACAGA
CTACCTCATGAAGATCCTGACCGAGCGTGGCTACAGCTTCACCACCACAGCTGAGAGGGAAATCGTGCGT
GACATCAAAGAGAAGCTGTGCTATGTTGCTCTAGACTTCGAGCAGGAGATGGCCACTGCCGCATCCTCTT
CCTCCCTGGAGAAGAGCTATGAGCTGCCTGACGGCCAGGTCATCACTATTGGCAACGAGCGGTTCCGATG
CCCTGAGGCTCTTTTCCAGCCTTCCTTCTTGGGTATGGAATCCTGTGGCATCCATGAAACTACATTCAAT
TCCATCATGAAGTGTGACGTTGACATCCGTAAAGACCTCTATGCCAACACAGTGCTGTCTGGTGGTACCA
CCATGTACCCAGGCATTGCTGACAGGATGCAGAAGGAGATTACTGCTCTGGCTCCTAGCACCATGAAGAT
CAAGATCATTGCTCCTCCTGAGCGCAAGTACTCTGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCC
ACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTACGATGAGTCCGGCCCCTCCATCGTGCACCGCAAGT
GCTTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_007393
Insert Size 1128 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC138611, AAI38612
RefSeq Size 1584 bp
RefSeq ORF 1128 bp
Locus ID 11461
UniProt ID P60710
Cytogenetics 5 81.8 cM
Summary This gene encodes a member of the actin family of proteins. Actins are highly conserved proteins that are among the most abundant proteins in eukaryotic cells and are involved in cell motility, structure, and integrity. Localization, stability, and translation of the transcribed mRNA are regulated through the binding of multiple factors to its 3' UTR sequence. Homozygous knockout mice for this gene exhibit embryonic lethality. Numerous pseudogenes of this gene have been identified in the mouse genome. [provided by RefSeq, Sep 2015]
Write Your Own Review
You're reviewing:Actb (NM_007393) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG225133 Actb (tGFP-tagged) - Mouse actin beta (Actb), (10ug) 10 ug
$886.00
MR225133 Actb (Myc-DDK-tagged) - Mouse actin, beta (Actb) 10 ug
$686.00
MR225133L3 Lenti ORF clone of Actb (Myc-DDK-tagged) - Mouse actin, beta (Actb) 10 ug
$986.00
MR225133L4 Lenti ORF clone of Actb (mGFP-tagged) - Mouse actin, beta (Actb) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.