Trp53inp2 (NM_178111) Mouse Untagged Clone

SKU
MC207669
Trp53inp2 (untagged) - Mouse transformation related protein 53 inducible nuclear protein 2 (Trp53inp2), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Trp53inp2
Synonyms 1110029F20Rik; Tp53inp2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207669 representing NM_178111
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCCAGCGCTTCACCAGCCTTTTCTTCAACACCCCTGCGCCTCCTGAAGACTCCAACTGTCCGGGGG
CCTTTGTCTCTGAGGAGGATGAAGTGGATGGCTGGCTCATCATCGACCTACAGGACAGCTATACAGCTCC
TCCCGACCCCGGGGCCTCGCCTGCTCCTGCAGGCCGCCCTCCACCCGCGCCCTCCTTGATGGATGAGAGC
TGGTTTGTTACCCCTCCCGCCTGTTTTACTGCAGAGGGGCCCGGCCTTGGGCCTGCCCGCCTCCAGAGCA
ATCCGCTGGAGGACCTCCTCATTGAGCATCCCAGCATGTCCGTTTATGTCACCGGCAGCACCATAGTGCT
GGAGTCTGGGCCACCTTCCCCTCACCCTGAAGCTGCCTTGCCTGATCAGGACCTCAGCGATGGAGAGCTG
GCGCCTGCCCTCCGGGAACCCAGGGCCTTGCACCACGCAGCTGCTCCTATGCCCGCTCGAGCTGTGCTGC
TGGAGAAGGCTGGCCAGGTGCGGAGGCTGCAGAGAGCCCGACAGCGGGCTGAGCGCCACACATTGAGTGC
TAAAGTGTTGCAACGGCAGAATCGCGCCCGGGAGAGCCGTTCGCGCCGGCCCAAGCACCAGGGCAGCTTT
ATTTACCAGCCGTGCCAGCGCCAGTTCAACTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_178111
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178111.3, NP_835212.1
RefSeq Size 3934 bp
RefSeq ORF 666 bp
Locus ID 68728
UniProt ID Q8CFU8
Cytogenetics 2 H1
Summary Dual regulator of transcription and autophagy. Positively regulates autophagy and is required for autophagosome formation and processing. May act as a scaffold protein that recruits MAP1LC3A, GABARAP and GABARAPL2 and brings them to the autophagosome membrane by interacting with VMP1 where, in cooperation with the BECN1-PI3-kinase class III complex, they trigger autophagosome development. Acts as a transcriptional activator of THRA.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Trp53inp2 (NM_178111) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202527 Trp53inp2 (tGFP-tagged) - Mouse transformation related protein 53 inducible nuclear protein 2 (Trp53inp2) 10 ug
$500.00
MR202527 Trp53inp2 (Myc-DDK-tagged) - Mouse transformation related protein 53 inducible nuclear protein 2 (Trp53inp2) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202527L3 Lenti ORF clone of Trp53inp2 (Myc-DDK-tagged) - Mouse transformation related protein 53 inducible nuclear protein 2 (Trp53inp2) 10 ug
$600.00
MR202527L4 Lenti ORF clone of Trp53inp2 (mGFP-tagged) - Mouse transformation related protein 53 inducible nuclear protein 2 (Trp53inp2) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.