Itm2c (NM_022417) Mouse Untagged Clone

SKU
MC207550
Itm2c (untagged) - Mouse integral membrane protein 2C (Itm2c), (10ug)
$330.00
4 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Itm2c
Synonyms 3110038L02Rik; BRI3; Bricd2c; E25; E25C; ITM3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207550 representing NM_022417
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAGATCAGTTTCCAGCCCGCGGTAGCGGGCATCAAGGCTGATAAAGCGGACAAAGCAGCGGCGT
CTGGTCCGGCCTCGGCATCTGCCCCGGCCGCGGAGATCCTGCTGACGCCGGCGAGGGAGGAACGCCCCCC
TCGCCACCGCTCCCGGAAAGGAGGCTCCGTGGGCGGCGTGTGCTACCTGTCCATGGGCATGGTTGTATTG
CTCATGGGCCTTGTGTTTGCCTCGGTCTACATCTACAGGTACTTCTTCCTTGCTCAGCTGGCCCGAGATA
ACTTCTTCCACTGTGGTGTGCTCTACGAAGACTCCCTGTCCTCCCAGATCCGGACTCGCCTGGAGCTGGA
AGAGGATGTGAAGATCTATCTTGAGGAGAACTATGAACGTATTAATGTCCCTGTGCCCCAGTTTGGTGGT
GGGGACCCTGCAGACATCATCCATGACTTCCAGCGGGGTCTCACTGCCTACCACGACATCTCCCTAGACA
AGTGCTACGTCATCGAGCTCAACACCACCATCGTGCTACCCCCACGAAACTTCTGGGAGCTCCTCATGAA
CGTGAAGAGAGGGACCTACCTCCCACAGACGTACATCATCCAGGAGGAGATGGTGGTGACAGAGCATGTC
CGCGACAAGGAGGCTCTGGGTTCCTTCATCTACCACCTGTGCAACGGGAAGGACACCTACCGGCTGCGGC
GCCGGTCTACCCGGAGGCGGATCAACAAACGTGGGGGCAAGAACTGCAACGCCATCCGCCACTTCGAGAA
TACATTTGTGGTGGAGACGCTCATCTGTGGGGTGGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_022417
Insert Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022417.3, NP_071862.2
RefSeq Size 2024 bp
RefSeq ORF 810 bp
Locus ID 64294
UniProt ID Q91VK4
Cytogenetics 1 C5
Summary Negative regulator of amyloid-beta peptide production. May inhibit the processing of APP by blocking its access to alpha- and beta-secretase. Binding to the beta-secretase-cleaved APP C-terminal fragment is negligible, suggesting that ITM2C is a poor gamma-secretase cleavage inhibitor. May play a role in TNF-induced cell death and neuronal differentiation.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Itm2c (NM_022417) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203562 Itm2c (tGFP-tagged) - Mouse integral membrane protein 2C (Itm2c) 10 ug
$500.00
MR203562 Itm2c (Myc-DDK-tagged) - Mouse integral membrane protein 2C (Itm2c) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR203562L3 Lenti ORF clone of Itm2c (Myc-DDK-tagged) - Mouse integral membrane protein 2C (Itm2c) 10 ug
$600.00
MR203562L4 Lenti ORF clone of Itm2c (mGFP-tagged) - Mouse integral membrane protein 2C (Itm2c) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.