Nhlh1 (NM_010916) Mouse Untagged Clone

SKU
MC207334
Nhlh1 (untagged) - Mouse nescient helix loop helix 1 (Nhlh1), (10ug)
$165.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nhlh1
Synonyms bHLHa35; Hen1; Nscl; Tal2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207334 representing NM_010916
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGCTCAACTCCGATACCATGGAGCTGGACCTGCCTCCCACCCACTCGGAGACCGAGTCGGGCTTTA
GCGACTGTGGGGGCGGACCGGGCCCCGATGGTGCTGGATCCGGGGATCCAGGAGTGGTCCAGGTCCGGAG
CTCAGAGCTTGGAGAGTCCGGCCGCAAAGACCTGCAGCACTTGAGTCGTGAGGAGCGCAGGCGCCGGCGC
CGCGCCACGGCCAAGTACCGCACGGCACACGCCACGCGGGAGCGCATCCGCGTGGAAGCCTTCAACCTAG
CCTTCGCCGAGCTGCGCAAGCTGCTGCCCACTCTGCCCCCGGACAAGAAGCTCTCTAAGATTGAGATCCT
ACGCCTGGCCATCTGCTATATCTCCTACCTGAACCATGTGCTGGACGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_010916
Insert Size 402 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_010916.2, NP_035046.1
RefSeq Size 2506 bp
RefSeq ORF 402 bp
Locus ID 18071
UniProt ID Q02576
Cytogenetics 1 79.54 cM
Summary May serve as DNA-binding protein and may be involved in the control of cell-type determination, possibly within the developing nervous system.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Nhlh1 (NM_010916) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200773 Nhlh1 (tGFP-tagged) - Mouse nescient helix loop helix 1 (Nhlh1) 10 ug
$350.00
MR200773 Nhlh1 (Myc-DDK-tagged) - Mouse nescient helix loop helix 1 (Nhlh1) 10 ug
$289.00
MR200773L3 Lenti ORF clone of Nhlh1 (Myc-DDK-tagged) - Mouse nescient helix loop helix 1 (Nhlh1) 10 ug
$450.00
MR200773L4 Lenti ORF clone of Nhlh1 (mGFP-tagged) - Mouse nescient helix loop helix 1 (Nhlh1) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.