Hmox1 (NM_010442) Mouse Untagged Clone

SKU
MC207301
Hmox1 (untagged) - Mouse heme oxygenase (decycling) 1 (Hmox1), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Hmox1
Synonyms D8Wsu38e; Hemox; Hmox; HO-1; HO1; Hsp32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207301 representing NM_010442
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGTCCACAGCCCGACAGCATGCCCCAGGATTTGTCTGAGGCCTTGAAGGAGGCCACCAAGGAGG
TACACATCCAAGCCGAGAATGCTGAGTTCATGAAGAACTTTCAGAAGGGTCAGGTGTCCAGAGAAGGCTT
TAAGCTGGTGATGGCTTCCTTGTACCATATCTACACGGCCCTGGAAGAGGAGATAGAGCGCAACAAGCAG
AACCCAGTCTATGCCCCACTCTACTTCCCTGAGGAGCTGCACCGAAGGGCTGCCCTGGAGCAGGACATGG
CCTTCTGGTATGGGCCTCACTGGCAGGAAATCATCCCTTGCACGCCAGCCACACAGCACTATGTAAAGCG
TCTCCACGAGGTGGGGCGCACTCACCCTGAGCTGCTGGTGGCCCACGCATATACCCGCTACCTGGGTGAC
CTCTCAGGGGGTCAGGTCCTGAAGAAGATTGCACAGAAGGCCATGGCCTTGCCCAGCTCTGGGGAGGGCC
TGGCTTTTTTTACCTTCCCGAACATCGACAGCCCCACCAAGTTCAAACAGCTCTATCGTGCTCGAATGAA
CACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAAC
ATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGG
CGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACC
CCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCA
ACAGTGGCAGTGGGAATTTATGCCATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_010442
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010757, AAH10757
RefSeq Size 1556 bp
RefSeq ORF 870 bp
Locus ID 15368
UniProt ID P14901
Cytogenetics 8 C1
Summary Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Exhibits cytoprotective effects since excess of free heme sensitizes cells to undergo apoptosis.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Hmox1 (NM_010442) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG203944 Hmox1 (tGFP-tagged) - Mouse heme oxygenase (decycling) 1 (Hmox1) 10 ug
$650.00
MR203944 Hmox1 (Myc-DDK-tagged) - Mouse heme oxygenase (decycling) 1 (Hmox1) 10 ug
$450.00
MR203944L1 Lenti ORF clone of Hmox1 (Myc-DDK-tagged) - Mouse heme oxygenase (decycling) 1 (Hmox1) 10 ug
$750.00
MR203944L2 Lenti ORF clone of Hmox1 (mGFP-tagged) - Mouse heme oxygenase (decycling) 1 (Hmox1) 10 ug
$750.00
MR203944L3 Lenti ORF clone of Hmox1 (Myc-DDK-tagged) - Mouse heme oxygenase (decycling) 1 (Hmox1) 10 ug
$750.00
MR203944L4 Lenti ORF clone of Hmox1 (mGFP-tagged) - Mouse heme oxygenase (decycling) 1 (Hmox1) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.