Fcgr2b (NM_010187) Mouse Untagged Clone
SKU
MC207272
Fcgr2b (untagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 2, (10ug)
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Fcgr2b |
Synonyms | AI528646; CD32; F630109E10Rik; Fcgr2; Fcgr2a; FcgRII; Fcr-2; Fcr-3; fcRII; Fc[g]RII; Ly-17 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>MC207272 representing NM_010187
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAATCCTGCCGTTCCTACTGATCCCCATGGAGAGCAACTGGACTGTTCATGTGTTCTCACGGACTT TGTGCCATATGCTACTGTGGACAGCCGTGCTAAATCTTGCTGCTGGGACTCATGATCTTCCAAAGGCTGT GGTCAAACTCGAGCCCCCGTGGATCCAGGTGCTCAAGGAAGACACGGTGACACTGACATGCGAAGGGACC CACAACCCTGGGAACTCTTCTACCCAGTGGTTCCACAATGGGAGGTCCATCCGGAGCCAGGTCCAAGCCA GCTACACGTTTAAGGCCACAGTCAATGACAGTGGAGAATATCGGTGTCAAATGGAGCAGACCCGCCTCAG CGACCCTGTAGATCTGGGAGTGATTTCTGACTGGCTGCTGCTCCAGACCCCTCAGCTGGTGTTTCTGGAA GGGGAAACCATCACGCTAAGGTGCCATAGCTGGAGGAACAAACCACTGAACAGGATCTCGTTCTTCCATA ATGAAAAATCCGTGAGGTATCATCACTACAGTAGTAATTTCTCTATCCCAAAAGCCAACCACAGTCACAG TGGGGACTACTACTGCAAAGGAAGTCTAGGAAGGACACAGCACCAGTCCAAGACTGTCACCATCACTGTC CAAGGGCCCAAGTCCAGCAGGTCTTTACCAGTATTGACAATTGTGGCTGCTGTCACTGGGATTGCTGTCG CAGCCATTGTTATTATCCTAGTATCCTTGGTCTATCTCAAGAAAAAACAGGTTCCAGACAATCCTCCTGA TCTGGAAGAAGCTGCCAAAACTGAGGCTGAGAATACGATCACCTACTCACTTCTCAAGCATCCCGAAGCC CTGGATGAAGAAACAGAGCATGATTACCAGAACCACATTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010187 |
Insert Size | 882 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | BC038070, AAH38070 |
RefSeq Size | 1407 bp |
RefSeq ORF | 882 bp |
Locus ID | 14130 |
UniProt ID | P08101 |
Cytogenetics | 1 78.02 cM |
Summary | Receptor for the Fc region of complexed immunoglobulins gamma. Low affinity receptor. Involved in a variety of effector and regulatory functions such as phagocytosis of antigen-antibody complexes from the circulation and modulation of antibody production by B-cells. Isoform IIB1 and isoform IIB1' form caps but fail to mediate endocytosis or phagocytosis. Isoform IIB2 can mediate the endocytosis of soluble immune complexes via clathrin-coated pits. Isoform IIB1 and isoform IIB2 can down-regulate B-cell, T-cell, and mast cell activation when coaggregated to B-cell receptors for AG (BCR), T-cell receptors for AG (TCR), and Fc receptors, respectively.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MR204036 | Fcgr2b (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 2 | 10 ug |
$450.00
|
|
MR204036L1 | Lenti ORF clone of Fcgr2b (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 2 | 10 ug |
$750.00
|
|
MR204036L2 | Lenti ORF clone of Fcgr2b (mGFP-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 2 | 10 ug |
$750.00
|
|
MR204036L3 | Lenti ORF clone of Fcgr2b (Myc-DDK-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 2 | 10 ug |
$750.00
|
|
MR204036L4 | Lenti ORF clone of Fcgr2b (mGFP-tagged) - Mouse Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 2 | 10 ug |
$750.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.