Cdk4 (NM_009870) Mouse Untagged Clone

SKU
MC207247
Cdk4 (untagged) - Mouse cyclin-dependent kinase 4 (Cdk4), (10ug)
$330.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cdk4
Synonyms Crk3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207247 representing NM_009870
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCCACTCGATATGAACCCGTGGCTGAAATTGGTGTCGGTGCCTATGGGACGGTGTACAAAGCCC
GAGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTTCCTAATGGAGGAGCAGCTGGAGG
GGGCCTTCCCGTCAGCACAGTTCGTGAGGTGGCCTTGTTAAGGAGGCTGGAGGCCTTTGAACATCCCAAT
GTTGTACGGCTGATGGATGTCTGTGCTACTTCCCGAACTGATCGGGACATCAAGGTCACCCTAGTGTTTG
AGCATATAGACCAGGACCTGAGGACATACCTGGACAAAGCACCTCCACCGGGCCTGCCGGTTGAGACCAT
TAAGGATCTAATGCGTCAGTTTCTAAGCGGCCTGGATTTTCTTCATGCAAACTGCATTGTTCACCGGGAC
CTGAAGCCAGAGAACATTCTAGTGACAAGTAATGGGACCGTCAAGCTGGCTGACTTTGGCCTAGCTAGAA
TCTACAGCTACCAGATGGCCCTCACGCCTGTGGTGGTTACGCTCTGGTACCGAGCTCCTGAAGTTCTTCT
GCAGTCTACATACGCAACACCCGTGGACATGTGGAGCGTTGGCTGTATCTTTGCAGAGATGTTCCGTCGG
AAGCCTCTCTTCTGTGGAAACTCTGAAGCCGACCAGTTGGGGAAAATCTTTGATCTCATTGGATTGCCTC
CAGAAGACGACTGGCCTCGAGAGGTATCTCTACCTCGAGGAGCCTTTGCCCCCAGAGGGCCTCGGCCAGT
GCAGTCAGTGGTGCCAGAGATGGAGGAGTCTGGAGCGCAGCTGCTACTGGAAATGCTGACCTTTAACCCA
CATAAGCGAATCTCTGCCTTCCGAGCCCTGCAGCACTCCTACCTGCACAAGGAGGAAAGCGACGCAGAGT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_009870
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009870.3, NP_034000.1
RefSeq Size 1365 bp
RefSeq ORF 912 bp
Locus ID 12567
UniProt ID P30285
Cytogenetics 10 D3
Summary Ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also phosphorylates SMAD3 in a cell-cycle-dependent manner and represses its transcriptional activity. Component of the ternary complex, cyclin D/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Cdk4 (NM_009870) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MR204246 Cdk4 (Myc-DDK-tagged) - Mouse cyclin-dependent kinase 4 (Cdk4) 10 ug
$450.00
MR204246L3 Lenti ORF clone of Cdk4 (Myc-DDK-tagged) - Mouse cyclin-dependent kinase 4 (Cdk4) 10 ug
$750.00
MR204246L4 Lenti ORF clone of Cdk4 (mGFP-tagged) - Mouse cyclin-dependent kinase 4 (Cdk4) 10 ug
$750.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.