Ms4a4b (BC028433) Mouse Untagged Clone

SKU
MC207085
Ms4a4b (untagged) - Mouse membrane-spanning 4-domains, subfamily A, member 4B (cDNA clone MGC:41078 IMAGE:1248222), (10ug)
$165.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ms4a4b
Synonyms AI463180; Chandra; Ly116
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC028433
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAAGGACAGGAACAGACCACCATGGCAGTGGTTCCTGGAGTTGCTGTGCCTTCAAAGAATTCTGTTA
TGACATCACAAATGTGGAATGAGAAGAAAGAGAAATTCTTGAAGGGGGAACCCAAAGTCCTTGGGGTTTT
ACAAGTGATGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTTGACAACTTTATTTTCTGAACTA
CCCACTTCAGTGATGTTAATGGTCCCAATTTGGGGATCAATAATGTTCATTGTCTCCGGATCCCTGTCCA
TTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATTTGGTATGTTTTGCTATGGAAAAGGAGTA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI
ACCN BC028433
Insert Size 351 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC028433, AAH28433
RefSeq Size 747 bp
RefSeq ORF 350 bp
Locus ID 60361
Cytogenetics 19 A
Write Your Own Review
You're reviewing:Ms4a4b (BC028433) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200489 Ms4a4b (tGFP-tagged) - Mouse membrane-spanning 4-domains, subfamily A, member 4B (cDNA clone MGC:41078 IMAGE:1248222) 10 ug
$350.00
MR200489 Ms4a4b (Myc-DDK-tagged) - Mouse membrane-spanning 4-domains, subfamily A, member 4B (cDNA clone MGC:41078 IMAGE:1248222) 10 ug
$289.00
MR200489L3 Lenti ORF clone of Ms4a4b (Myc-DDK-tagged) - Mouse membrane-spanning 4-domains, subfamily A, member 4B (cDNA clone MGC:41078 IMAGE:1248222) 10 ug
$450.00
MR200489L4 Lenti ORF clone of Ms4a4b (mGFP-tagged) - Mouse membrane-spanning 4-domains, subfamily A, member 4B (cDNA clone MGC:41078 IMAGE:1248222) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.