Ric3 (BC059258) Mouse Untagged Clone

SKU
MC206998
Ric3 (untagged) - Mouse resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (cDNA clone MGC:67601 IMAGE:6408852), complete, (10ug)
$330.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ric3
Synonyms E130307J04Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206998 representing BC059258.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAAAATTAATCAACAGAGTTGGACCTAATGGTGAGAGCAGAGCACAGGCTGTGACTTCTGACCAA
GAGAAACGATTACTGCATCAGCTCCGAGAAATCACCAGGGTCATGAAAGAAGGCAAGTTCATCGACACA
TCTCCAGAGAAGGAAGCTGAGGAAGCCCCATACATGGAGGACTGGGAAGGTTACCCAGAAGAGACTTAT
CCAATATATGACCTTTCGGATGGTATCAAGCGTAGGCAAGAAACAATCCTGGTGGATTACCCTGACCTA
AAAGAGCCCTCTGCTGAAGAAATTGCTGAACAAATGGGAGAGATAGAAGAGGAAGGATCAGAGCGTTTG
AGCTGGGATCATTTGCCCACTGACCCTGGAGCCCAGAAAGATAATTCTGTTGCCCCGTGTGATCCCAAA
CCAGAATCATGCTCCTGCTGTGTTCATGAAGAGGAGGATCCTGCTGTCTTGGCAGAGAATGCTGGTTTC
AGTGCAGATGGCTACAGTGAGCAAGAGGAAGCCACCAAGGAAAACTTGCCCCAGGACTTTACAAATGAA
GGGCTGGGAGTCAGCACTGATAATGCACACGTGGGTGGTATGTTGAGGAAGCGCAACCCCCAGGGTTTT
GAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN BC059258
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC059258
RefSeq Size 5045 bp
RefSeq ORF 626 bp
Locus ID 320360
Cytogenetics 7 E3
MW 23.3 kDa
Summary Promotes functional expression of homomeric alpha-7 and alpha-8 nicotinic acetylcholine receptors at the cell surface. May also promote functional expression of homomeric serotoninergic 5-HT3 receptors, and of heteromeric acetylcholine receptors alpha-3/beta-2, alpha-3/beta-4, alpha-4/beta-2 and alpha-4/beta-4.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Ric3 (BC059258) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202225 Ric3 (tGFP-tagged) - Mouse resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (cDNA clone MGC:67601 IMAGE:6408852), complete 10 ug
$500.00
MR202225 Ric3 (Myc-DDK-tagged) - Mouse resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (cDNA clone MGC:67601 IMAGE:6408852), complete 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202225L3 Lenti ORF clone of Ric3 (Myc-DDK-tagged) - Mouse resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (cDNA clone MGC:67601 IMAGE:6408852), complete 10 ug
$600.00
MR202225L4 Lenti ORF clone of Ric3 (mGFP-tagged) - Mouse resistance to inhibitors of cholinesterase 3 homolog (C. elegans) (cDNA clone MGC:67601 IMAGE:6408852), complete 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.