6230409E13Rik (BC059864) Mouse Untagged Clone

SKU
MC206959
6230409E13Rik (untagged) - Mouse RIKEN cDNA 6230409E13 gene (cDNA clone MGC:69721 IMAGE:6417471), (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol 6230409E13Rik
Synonyms 6230409E13Rik; AW742931
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206959 representing BC059864.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGACCCAAGCTTTCCACTCTTGATGCCACTGTCTTTGGACACTTGGCACAGGCGATGTGGACCTTA
CCAGGGACAAGACCGGAGCGGCTAATCAAAGGCGAGCTGATCAACCTGGCCATGTACTGCGAGAGGATC
AGGAGGAAATTCTGGCCCGAGTGGCACCACGATGATGACAACACCATTTATGAGTCTGAGGAGAGCAGC
GAGGGCAGCAAGACTCACACACCCATGCTGGATTTTAGCTTTTACTCCAGGACAGAGACCTTTGAGGAC
GAGGGGGCTGAGAACAGTTTCTCCAGGACCCCAGACACGGATTTCACCGGACACTCTCTCTTTGACTCC
GATGTGGAGATGGATGACTACACAGACCACGAACAGTGCAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN BC059864
Insert Size 390 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC059864
RefSeq Size 4035 bp
RefSeq ORF 389 bp
Locus ID 76132
Cytogenetics 4 A3
MW 15 kDa
Summary May play a role in axonal development.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:6230409E13Rik (BC059864) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200717 6230409E13Rik (tGFP-tagged) - Mouse RIKEN cDNA 6230409E13 gene (cDNA clone MGC:69721 IMAGE:6417471) 10 ug
$350.00
MR200717 6230409E13Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 6230409E13 gene (cDNA clone MGC:69721 IMAGE:6417471) 10 ug
$289.00
MR200717L3 Lenti ORF clone of 6230409E13Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 6230409E13 gene (cDNA clone MGC:69721 IMAGE:6417471) 10 ug
$450.00
MR200717L4 Lenti ORF clone of 6230409E13Rik (mGFP-tagged) - Mouse RIKEN cDNA 6230409E13 gene (cDNA clone MGC:69721 IMAGE:6417471) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.